Information

Regulation in plants bearing cleistogamous and chasmogamous flowers


In most plants bearing cleistogamous flowers, chasmogamous flowers are also borne by the plants. For example, Viola, Oxalis and Commelina contain both these kinds of flowers.( I am unaware of a species which bears only cleistogamous flowers, which would be very unfavourable for evolutionary success)

The Cleistogamous flowers help in reproduction with minimal energy and resource expenditure. It also maximises the chance of reproduction, which is an important factor where the agents of pollination are scarce. On the other hand Chasmogamous flowers provide variablity, hybrid vigour and generate better genotypes through recombination. Both of these strategies are useful in different environment. In adverse (less pollinators, energy stress) cleistogamy would be favourable, and in other cases where no energy stress prevails, chsmogamy is advantageous.

My question is, How can plants, if they can, regulate which strategy is supported? Is the ratio of cleistogamous to chasmogamous flowers constant irrespective of the environment, or does the prevailing environment have a say in deciding which of these two kinds of flowers will be preferred over the other? If it does, what is the regulatory mechanism underlying this control of flowering startegies?

One other related question is whether there are any species which bear only cleistogamous flowers? That would seem very unfavourable for evolution to act on.


This is a very good question, but I think the reason that it's not being answered is because it is in a sense too broad: different plant groups maintain balances of cleistogamous and chasmogamous flowers, and they modulate that balance through different mechanisms. Many of these mechanisms (genes involved, environmental cues, developmental pathways) may not be fully understood.

Culley and Klooster (2007) categorize cleistogamy depending on the degree to which "the prevailing environment has a say":

  • In dimorphic cleistogamy CL and CH flower differ in the time or place of production, with CL flowers produced in conditions (underground, low light levels, early in the season) that are potentially unfavorable for outcrossing.
  • In induced cleistogamy potentially CH flowers that experience conditions such as drought or low temperatures fail to open and self-pollinate, becoming, in effect, CL flowers.

You should check out the Culley and Klooster (available online if you make a jstor login) - they discuss complete cleistogamy which addresses your last question. They report several completely CL species in their Table 1, and give references.

More generally, many different plant groups maintain balances of self-pollination and outcrossing (i.e. "real sex"), through an even more diverse set of mechanisms.

Even more generally, many plants and some animals maintain balances of sexual reproduction and clonal reproduction, through an even more diverse set of mechanisms. For instance, vegetative reproduction (e.g., strawberry runners) is very common in many plant groups; facultative and obligate parthenogenesis in animals also occurs.


Culley, Theresa M. and Matthew R. Klooster (2007). The Cleistogamous Breeding System: A Review of Its Frequency, Evolution, and Ecology in Angiosperms. Botanical Review. Vol. 73, No. 1, pp. 1-30


The genome of Cleistogenes songorica provides a blueprint for functional dissection of dimorphic flower differentiation and drought adaptability

Cleistogenes songorica (2n = 4x = 40) is a desert grass with a unique dimorphic flowering mechanism and an ability to survive extreme drought. Little is known about the genetics underlying drought tolerance and its reproductive adaptability. Here, we sequenced and assembled a high-quality chromosome-level C. songorica genome (contig N50 = 21.28 Mb). Complete assemblies of all telomeres, and of ten chromosomes were derived. C. songorica underwent a recent tetraploidization (

19 million years ago) and four major chromosomal rearrangements. Expanded genes were significantly enriched in fatty acid elongation, phenylpropanoid biosynthesis, starch and sucrose metabolism, and circadian rhythm pathways. By comparative transcriptomic analysis we found that conserved drought tolerance related genes were expanded. Transcription of CsMYB genes was associated with differential development of chasmogamous and cleistogamous flowers, as well as drought tolerance. Furthermore, we found that regulation modules encompassing miRNA, transcription factors and target genes are involved in dimorphic flower development, validated by overexpression of CsAP2_9 and its targeted miR172 in rice. Our findings enable further understanding of the mechanisms of drought tolerance and flowering in C. songorica, and provide new insights into the adaptability of native grass species in evolution, along with potential resources for trait improvement in agronomically important species.

Keywords: Cleistogenes songorica allotetraploid cleistogamy dimorphic flower drought tolerance genome assembly.

© 2020 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.


Genome-Wide Analysis of the Role of NAC Family in Flower Development and Abiotic Stress Responses in Cleistogenes songorica

Plant-specific NAC (NAM, ATAF, CUC) transcription factor (TF) family plays important roles in biological processes such as plant growth and response to stress. Nevertheless, no information is known about NAC TFs in Cleistogenes songorica, a prominent xerophyte desert grass in northwestern China. In this study, 162 NAC genes were found from the Cleistogenes songorica genome, among which 156 C. songoricaNAC (CsNAC) genes (96.3%) were mapped onto 20 chromosomes. The phylogenetic tree constructed by CsNAC and rice NAC TFs can be separated into 14 subfamilies. Syntenic and Ka/Ks analyses showed that CsNACs were primarily expanded by genomewide replication events, and purifying selection was the primary force driving the evolution of CsNAC family genes. The CsNAC gene expression profiles showed that 36 CsNAC genes showed differential expression between cleistogamous (CL) and chasmogamous (CH) flowers. One hundred and two CsNAC genes showed differential expression under heat, cold, drought, salt and ABA treatment. Twenty-three CsNAC genes were commonly differentially expressed both under stress responses and during dimorphic floret development. Gene Ontology (GO) annotation, coexpression network and qRT-PCR tests revealed that these CsNAC genes may simultaneously regulate dimorphic floret development and the response to stress. Our results may help to characterize the NAC transcription factors in C. songorica and provide new insights into the functional research and application of the NAC family in crop improvement, especially in dimorphic floret plants.

Keywords: Cleistogenes songorica NAC abiotic stress cleistogamous genome-wide.

Conflict of interest statement

The authors declare no conflict of interest.

Figures

Phylogenetic tree of NAC transcription…

Phylogenetic tree of NAC transcription factors (TFs) in C. songorica and rice. The…

Schematic representations of syntentic relationships…

Schematic representations of syntentic relationships of NAC members between C. songorica and rice.…

Ks and Ka/Ks value distributions…

Ks and Ka/Ks value distributions of the NAC members in C. songorica and…

Phylogenetic relationships, gene structure and…

Phylogenetic relationships, gene structure and putative conserved domain distributions of the CsNAC family.…

Distribution of the NAC duplicated…

Distribution of the NAC duplicated genes in C. songorica. The colored lines within…

Chromosomal location of C. songorica…

Chromosomal location of C. songorica NAC genes. The chromosome number is above each…

Expression profiles and coexpression network…

Expression profiles and coexpression network of CsNAC TFs during dimorphic floret development. (…

Expression profiles and coexpression network…

Expression profiles and coexpression network analysis of abiotic stress-associated CsNAC genes. ( a…

The expression of selected CsNAC…

The expression of selected CsNAC genes under abiotic stress in shoots by qRT-PCR.…


Introduction

The genus Viola (violets) is distributed in both the northern and southern temperate regions as well as the tropics and possesses high diversity with 580� species, extensive allopolyploidy, and a distinct cytogenetic evolutionary history (Ballard et al., 1998 Marcussen et al., 2012, 2015 Wahlert et al., 2014). Viola is the largest genus in Violaceae, a family with moderately close relationships to the passionflower (Passifloraceae) and willow (Salicaceae) families in the order Malpighiales (Savolainen et al., 2000 Tokuoka and Hiroshi, 2006). Members of Viola exhibit frequent hybridization, diverse growth forms, assorted pollination and seed dispersal strategies, and varied breeding systems (Beattie, 1969, 1971 Beattie and Lyons, 1975 Ballard et al., 2011, 2014). Violets have been the fourth most popular bedding plant group (pansies), via sales, in the United States and abroad (Altland et al., 2003) and show potential for bioremediation (Hermann et al., 2013) and development of novel compounds for human use (Craik et al., 1999). Viola pubescens (Figure 1) is a perennial Viola herb commonly found in the understory of mesic forests in eastern North America. Most Viola species, including V. pubescens, possess and evolutionarily successful yet genetically uncharacterized mixed breeding system of both chasmogamous and cleistogamous flowers. While cleistogamous flowers are bud-like in appearance (Figure 1A) and mechanically sealed throughout their entire lifecycle, resulting in forced autogamy, chasmogamous flowers open at maturity, exposing their inner floral parts (Figure 1B). Cross-pollinated chasmogamous flowers have the advantage of sexual reproduction between two disparate parents offering genetically diverse progeny, reduced inbreeding depression, and removal of deleterious alleles from the population (Ballard et al., 2011). However, fertilization of chasmogamous flowers is contingent upon the availability of pollinating agents, and their nectar and showy floral organs require large amounts of energy and resources. The minute floral organs and lack of nectar in cleistogamous flowers make them less costly to produce and they have more resources for seed production including increases in overall seed number and/or larger seeds with higher viability (Culley and Klooster, 2007). Culley and Klooster (2007) conducted a survey investigating the occurrence of the chasmogamous/cleistogamous mixed breeding system, reporting a total of 536 species encompassing 41 diverse plant families, with the most occurrences reported in Poaceae (grasses), Fabaceae (legumes), Violaceae (violets), and Orchidaceae (orchids). Ballard et al. (2011) provided a comprehensive review of the literature on this mixed breeding system and highlighted the lack of information on the genetic basis of the system. However, the widespread distribution of the chasmogamous/cleistogamous mixed breeding system among monocot and dicot families as well as its expansive geographic range, suggests that the breeding system has evolved many times through the angiosperms (Ballard et al., 2011). This broad distribution also implies that the mixed breeding system is not a randomly occurring mating strategy and may be actively selected.

Figure 1. Viola pubescens var. scabriuscula bearing (A) cleistogamous and (B) chasmogamous flowers. Photographs were taken over native populations located in Sells Park, Athens County, Ohio, 45701 (39뀠�.6′′N 82뀄�.9′′W).

In addition to having evolutionarily advantageous mixed breeding systems, members of Violaceae also produce cyclotides. Cyclotides represent the largest circular protein family and have been classified as plant defense proteins based on their insecticidal (Jennings et al., 2001) and antimicrobial (Tam et al., 1999) properties but also have properties identified as anti-HIV (Gustafson et al., 1994), anti-cancer (Guzmán-Rodríguez et al., 2015), hemolytic (Tam et al., 1999), cytotoxic (Lindholm et al., 2002 Herrmann et al., 2008), trypsin inhibiting (Trabi and Craik, 2002) and uterotonic (Gran, 1973) among others (Zhang et al., 2009). Cyclotides are characterized by their cyclic cystine knot (CCK) motif of six conserved cys residues forming a tight network of disulfide bonds. This stable structure makes cyclotides resistant to proteolysis and strong candidates for drug design scaffolds and agrochemical applications (Craik et al., 1999 Gruber et al., 2008). With increased availability of genomic data, in silico methods have facilitated the discovery of many novel cyclotide sequences. The majority of cyclotides recently discovered are in Violaceae, which is speculated to contain upward of 30,000 unique cyclotides (Zhang et al., 2015). While only a small percentage of species in other cyclotide producing families have tested positive for cyclotide presence, cyclotide expression appears to be ubiquitous in Violaceae, and cyclotides have been identified in all species investigated (Burman et al., 2015 Göransson et al., 2015 Ravipati et al., 2017). While nine Viola transcriptomes have been sequenced to date (Supplementary Table S1), no Viola genome has been assembled (Matasci et al., 2014). The draft V. pubescens genome fills this gap in genomic data and provides a unique resource of sequencing and gene expression data. Here we present the de novo assembly and annotation of the V. pubescens draft genome and its use to investigate tissue-specific gene expression and cyclotide diversity in V. pubescens. These analyses provide insight into genetic disparities between chasmogamous and cleistogamous flowers and identified 81 cyclotide sequences.


Methods

Plant materials

Cardamine kokaiensis Yahara (Brassicaceae) is an annual cleistogamous herb that grows only near the Kokai River, Ibaraki Prefecture, Japan (36°1′58″N, 140°0′27″E). This plant was discovered by T. Yahara (Kyushu University, Japan) and will be described under this species name elsewhere (Yahara, personal communication). The water level of the Kokai River increases from autumn to early winter and decreases from mid-winter to spring. Thus, seeds are soaked in water and begin to germinate when the water level decreases. Individuals that germinate early (i.e. in January and February) have short soaking periods and long growth periods, become larger plants, and produce CL and CH flowers. Individuals that germinate later (i.e. in March and April) have long soaking periods and short growth periods, become smaller plants, and produce only CL flowers. Seeds are likely vernalized by soaking. CH flowers have four sepals, four petals, two lateral stamens, four medial stamens, and one pistil (Fig. S1 in Supplementary Material). Lateral stamens are shorter than medial stamens. These flowers, which are morphologically similar to A. thaliana flowers, have the capacity for both self- and outcross-pollination. In contrast, CL flowers lack petals and lateral stamens (Supplementary Fig. S1) and are obligatory self-pollinated.

In April 2003, C. kokaiensis plants were collected from the Kokai River. After the plants were self-pollinated and cultivated for four generations, single descendant seeds were used in experiments. Self-pollinated seeds from both CH and CL flowers were fertile (Morinaga et al. unpubl. data).

Chilling experiments

Because cleistogamy is often related to plant size, we focused on the environmental conditions that influence changes in plant size. Cardamine flexuosa is a closely related species to C. kokaiensis. The size of C. flexuosa plants is affected by different chilling treatments, which was interpreted as a vernalization effect ( Kudoh et al. 1995 , 1996 ).

Therefore, we conducted chilling treatments to examine the phenotypic responses of floral traits and plant size of C. kokaiensis under seven growth conditions: chilling treatments after germination for 14, 28, or 56 days (0–14, 0–28, and 0–56 treatments, respectively), chilling treatments before germination for 14, 28, or 56 days (14–0, 28–0, and 56–0 treatments, respectively), and no chilling (0–0 control).

Plants were cultivated in a growth chamber at 22 °C under 16 h light and 8 h darkness. Chilling was performed at 4 °C under 24 h darkness. Five plants that germinated from single descendant seeds self-pollinated for four generations were used for each experiment. The seeds were sown on medium containing 0.46% Murashige and Skoog Plant Salt Mixture (Wako Pure Chemical Industries, Osaka, Japan), 0.1% Gamborg's vitamin solution 1000× (Sigma-Aldrich, St. Louis, MO, USA), 1% sucrose, and 0.8% agar. Each seedling was transplanted to a 125-mL pot containing a 2 : 1 mixture of vermiculite and perlite. The plants were watered and fertilized (HYPONeX, Hyponex, Marysville, OH, USA) every 3–4 days.

The first and fifteenth flowers of the first flowering inflorescence of each plant were sampled. One sample of sepal, petal, lateral stamen, medial stamen, and pistil was randomly collected from each flower, and their length measured to the nearest 0.1 mm under a stereomicroscope. The number of days to flowering without chilling treatment was recorded. The dry weight of each plant was measured to the nearest 1 mg after drying in an oven at 60 °C for 72 h when its fifteenth flower had opened. We examined differences in the length of floral organs, days to flowering, and plant dry mass between treatments using one-way analysis of variance ( anova ) and post hoc Tukey's test. These statistical analyses were conducted using stat view 5.0 (SAS Institute Inc., Cary, NC, USA).

Genomic dna hybridization and probe selection

We used a genomic DNA (gDNA)-based probe-selection strategy ( Hammond et al. 2005 ) to check for the quality of the cross-species microarray. Cardamine kokaiensis gDNA was hybridized to a GeneChip A. thaliana ATH1 array (Affymetrix, Santa Clara, CA, USA), in which 22 810 probe-sets were scanned and at least 11 probe-pairs (i.e. perfect-match and mismatch probes) were allocated for each probe-set. Probe-pairs were selected for gene expression analysis based on C. kokaiensis gDNA hybridization intensity thresholds ranging from 0 (no probe selection) to 300 according to Hammond et al. (2005 ) (Supplementary Appendix S1). In the resulting optimal probe-selection strategy for gene expression analysis of C. kokaiensis, we used gDNA hybridization intensity thresholds of 50, 75, and 100 (Supplementary Appendix S1).

Cross-species microarray experiments

We investigated the gene expression patterns among CH, intermediate (INT), and CL flowers. Three chilling treatments were performed at 4 °C in darkness: before germination for 14 days or after germination for 14 or 28 days (14–0, 0–14, and 0–28 treatments, respectively). The first flowers of 14–0, 0–14, and 0–28 plants produced CH, INT, and CL flowers, respectively. We performed two biological replications per treatment. Biological replications were technically replicated once per treatment. For each replication, RNA was extracted from 160 plants that were germinated from single descendant seeds self-pollinated for four generations. The first inflorescence with flower primordia was collected from each plant when the first flower bud was visible. We placed the 160 inflorescence of the 160 plants in a same microtube. Total RNA was extracted from six samples (i.e. two biological replications of three treatments) using Isogen (Nippon Gene, Tokyo, Japan). The quality and quantity of total RNA were checked using an RNA Nano Labchip and 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA, USA).

Double-strand cDNA synthesis, cRNA synthesis, labelling, hybridization, and scanning for Affymetrix ATH1 arrays were performed according to the manufacturer's instructions <http://www.affymetrix.com/support/technical/manual/expression_manual.affx>. CEL files (CL1, CL2, INT1, INT2, CH1, and CH2.cel, accession no. GSE9799 in GEO) were generated using a Microarray Analysis Suite. This experiment was performed on two different days: the CL1 and CH1.cel were generated on 26 November 2004 and the others were generated on 22 March 2005. CEL files were loaded into GeneSpring (Agilent Technologies, USA) analysis software package using the robust multichip average (RMA) pre-normalization algorithm ( Irizarry et al. 2003 ). During CEL file loading, calculation of intensities for each probe-set, and pre-normalization, CEL files were interpreted using data files generated from gDNA hybridization intensity thresholds of 50, 75, and 100 that were considered an optimal range for probe-selection for gene expression analysis based on gDNA hybridization experiment (Appendix S1). We performed per-chip normalization, that is, the intensity of each probe-set was divided by the median intensity of all genes in the array. Genes with different signal intensities between CL and CH flowers were analysed with one-way anova and fold-change using GeneSpring. Furthermore, when selecting for high and low values of differentially expressed genes in CL and CH flowers, we used strict fold-change to consider the effects of experiment day (26 November 2004 and 22 March 2005) in signal intensity. The strict fold-change was considered the lowest value of either ratio obtained from both the days.

Semi-quantitative reverse transcription polymerase chain reaction (rt-pcr)

The double-stranded cDNA performed in the cross-species microarray experiments was also used for semi-quantitative RT-PCR to validate the microarray results. Primers for RT-PCR of 13 genes differentially and not differentially expressed were designed based on exon regions that were well conserved among A. thaliana and other organisms using Primer 3 <http://biotools.umassmed.edu/bioapps/primer3_www.cgi>. Identities of the amplified PCR products of seven genes were confirmed by sequencing using an ABI Prism 3130xl sequencer (Applied Biosystems, Foster City, CA, USA). Cardamine kokaiensis orthologues of A. thaliana DRM1, SPL5, AT4G29190, HSP81-4, NMT1, RD21, and ACTIN2 genes were amplified by primer sets (Table 1). Each semi-quantitative RT-PCR was carried out using a GeneAmp PCR system 9700 (Applied Biosystems) and EX Taq HS (TaKaRa, Shiga, Japan) in a 25-µL total volume containing 40 ng of double-strand cDNA. The PCR program consisted of 1 cycle at 94 °C for 5 min followed by 27 (ACTIN2 ortholog gene) or 29 (other genes) cycles of 94 °C for 30 s, 55 °C for 30 s, and 72 °C for 30 s. PCR products were not saturated under these conditions. PCR products were electrophoresed in 1% agarose gel and detected by ethidium bromide staining. Analyses of expression intensities were performed using Gel Analyzer in ImageJ <http://rsb.info.nih.gov/ij/>. The relative gene expression was calculated as:

Orthologous genes Forward primer Reverse primer
DRM1 ACGACTCCAGGATCGGTGA CCGAACAGTAGAATTATTATTACAAGA
SPL5 CACAATGAAAGGAGGAGGAAG CATAAGTCTTTTACATTTGCGGATA
AT4G29190 GCGTTTCAGCTCTCGATTTC GGGTACGGGTCGGATTTTAT
HSP81-4 CCTTGGGTTTGTCAAGGGTA CCTTCCTTGGTTGCAGAGAC
NMT1 CAATGGTCATCGCATCATGT CTCCCGTCACGATCTTGTTT
RD21 AGCATTCCGCTGATCTGACT TGGAATAGAAACGGGGTTCA
ACTIN2 TTGTTGGTAGGCCAAGACATC GGCATGAGGAAGAGAGAAACC

Relative gene expression (%) = (objective gene expression)/(ACTIN2 ortholog gene expression). The relative gene expression in the cross-species microarray was also calculated based on the gDNA hybridization intensity threshold of 100.


Regulation in plants bearing cleistogamous and chasmogamous flowers - Biology

You have requested a machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Neither BioOne nor the owners and publishers of the content make, and they explicitly disclaim, any express or implied representations or warranties of any kind, including, without limitation, representations and warranties as to the functionality of the translation feature or the accuracy or completeness of the translations.

Translations are not retained in our system. Your use of this feature and the translations is subject to all use restrictions contained in the Terms and Conditions of Use of the BioOne website.

The potential role of two LEAFY orthologs in the chasmogamous/cleistogamous mixed breeding system of Viola pubescens (Violaceae) 1

Yunjing Wang, 1 Harvey E. Ballard, 1 Anne L. Sternberger 1

1 Department of Environmental and Plant Biology, 315 Porter Hall, Ohio University, Athens, OH 45701

Includes PDF & HTML, when available

This article is only available to subscribers.
It is not available for individual sale.

Many plants, including most species in Viola, produce both open, outcrossing chasmogamous and closed, self-pollinating cleistogamous flowers. The chasmogamous/cleistogamous mixed breeding system is considered an evolutionarily successful reproductive strategy, but the underlying molecular basis remains largely unknown. The LEAFY (LFY) gene in Arabidopsis is responsible for the initiation of floral meristems and the regulation of flower development therefore, we sought to identify LFY orthologs in Viola pubescens Aiton with the goal of understanding possible differences in the regulatory genetics of flower development and the molecular genetics underlying chasmogamous/cleistogamous mixed breeding systems. A genomic library of V. pubescens was constructed to identify LFY orthologs, and reverse transcription polymerase chain reaction was employed to study gene expression in both flower types. In addition, overexpression studies of the orthologs were carried out in Arabidopsis to explore their role in the breeding system of Viola. Two LFY orthologs, VpLFY1 and VpLFY2, were isolated from a genomic library of V. pubescens . Both genes were expressed in both flower types, especially in young floral buds. However, over-expression of VpLFY2, but not VpLFY1, caused precocious flowering in Arabidopsis, indicating a potentially unique role of each ortholog. The results suggest that VpLFY1 and VpLFY2 function together in flower development of V. pubescens . The different effects caused by VpLFY1 and VpLFY2 in Arabidopsis indicate that the two orthologs may have unique, gene-specific properties that might contribute to the flower type in violets.


Methods

Plant materials

Materials for the transcriptome sequencing study were collected from a natural population from Mount Lao, located near the East China Sea on the south-eastern coastline of the Shandong Peninsula in China (120°36′10″E, 36°06′27″N). CH flower buds were collected on 8 April, 2014 (average minimum temperature is 8 °C, average maximum temperature is 15 °C and average precipitation is 36 mm in April http://qingdao.tianqi.com/laoshan/). CL flower buds were collected on 26 May, 2014 (average minimum temperature is 13 °C, average maximum temperature is 20 °C and average precipitation is 54 mm in May http://qingdao.tianqi.com/laoshan/). Both CH and CL whole dichotomous inflorescences were collected around 9:00 am −10:00 am, with each inflorescence including 3–5 flower buds at different developmental stages. The first flower bud of a dichotomous inflorescence (the oldest one) is well-developed with all of floral organs about 5 mm in size in the CH flower bud and 3 mm in the CL flower bud. The second flower bud is younger than the first and the third flower bud is the youngest of all. In most cases, there are 1–2 barely-visible flower buds located at the bottom of bract. CH and CL flower buds were collected fresh, frozen immediately in liquid nitrogen and then were transported in dry ice to a freezer where they were stored at −80 °C.

Sequencing

CH and CL flower libraries were generated from flower buds, and each flower bud sample consisted of a mixture of flower buds from different developmental stages obtained from 50 individuals of the same P. heterophylla population. For each kind of flower, total RNA was isolated from the flower buds using Trizol Reagent (Invitrogen) and treated with DNaseI (Promega) to remove residual contaminating DNA. The quality and integrity of the RNA were determined using an Agilent 2100 Bioanalyzer (Agilent). Two RNA-seq libraries (e.g. CH flowers and CL flowers) were prepared using the Illumina TruSeqRNA Sample Preparation Kit (Illumina) following the manufacturer’s instructions. Two normalized cDNA libraries (CH flowers, CL flowers) were constructed and sequenced using the Illumina HiSeq platform (Shanghai Personal Biotechnology Co. Ltd, China) to generate 100 bp paired-end raw reads.

Assembly and functional annotation

Clean reads were obtained by removing adaptor sequences, low-quality reads, and shorter reads (shorter than 50 bp). Trinity (http://trinityrnaseq.github.io) was used to assemble the quality reads into contigs and transcripts [71]. Basic Local Alignment Search Tool (BLAST) was utilized for searching sequence alignments (E-value <1.00E-5) between unique sequences and the non-redundant NCBI (http://www.ncbi.nlm.nih.gov/) and Swiss-Prot (http://www.expasy.ch/sprot) databases. The best-hit transcripts were selected as unigenes. The unigenes with functional categories were annotated by the Gene Ontology database (GO, http://www.geneontology.org) [72], Non-supervised Orthologous Groups (eggNOG) database (http://eggnog.embl.de/) [73], and the Kyoto Encyclopedia of Genes and Genomes database (KEGG, (http://www.genome.jp/kegg/) [74].

Identification of differentially expressed transcripts

Reads per kilobase of exon per million mapped reads (RPKM) [75] were used to normalize the abundance of transcripts on the basis of eliminating the influence of different gene lengths and sequencing discrepancies. Transcripts differentially expressed between the CH and CL flower libraries were identified using DEseq [76]. DETs between two libraries were required to have an absolute value of a log2foldchange (log2FC) > 2 in expression, a p-value of <0.001and an FDR <0.05 [77, 78].

The DETs were subjected to GO and KEGG Orthology (KO) enrichment analysis on the basis of a hypergeometric test (cutoff: FDR <0.05). The KEGG database was also used to predict the pathways in which the DETs were involved, and the pathway annotation was identified by the KEGG mapper (http://www.genome.jp/kegg/tool/map_pathway2.html).

Identification of genes involved in flowering processes

A total of 599Arabidopsis genes associated with gene regulatory networks controlling flowering processes were obtained from GO terms (GO: 0009908 flower development, GO: 0009909 regulation of flower development, GO: 0048439 flower morphogenesis, GO: 0048438 flower whorl development GO: 0048440 carpel development, GO: 0010093 specification of floral organ identity, GO: 0048497 maintenance of floral organ identity, etc., http://amigo.geneontology.org/) as well as from Srikanth & Schmid [22] and Alvarez-Buylla et al. [24]. The sequences of these genes were downloaded from the Arabidopsis Information Resource (TAIR, http://Arabidopsis.org/). We used the Arabidopsis genes involved in flowering processes as query sequences to search potential homologous genes among the transcript sequences of P. heterophylla by stand-alone BLAST (2.2.30+ version, ftp://ftp.ncbi.nlm.nih.gov/blast/executables/blast+/LATEST/) with an E-value <1.00E-10. All hits with identities above 60 % were considered to be homologous genes in P. heterophylla.

Validation of floral genes by quantitative real-time PCR

Twenty-four transcripts related to gene regulatory networks of flowering processes identified in the transcriptome sequencing analysis were validated and quantified using quantitative real-time PCR (qRT-PCR). Primers were designed using Primer Premier 5 according to transcriptome sequencing data (Additional file 4). Total RNA was obtained from the biological replicates of those samples used for RNA sequencing. Reverse cDNA was synthesized using PrimeScript Reagent Kit with gDNA Eraser (Takara), and RT-PCR was performed using an Eppendorf Master cycler. P. heterophylla β-actin was used as an internal control to normalize the expression level, and all experiments were performed with three repeats. The reaction was carried out in a total volume of 10 μL containing 5 μL SYBR Green Master Mix (Takara), 1 μL diluted cDNA mix, 0.5 μL each primer (10 mM), and 3 μL RNase-free water. The reactions were performed in a LightCycler480 real-time PCR system (Roche) at 95 °C for 30 s, followed by 45 cycles of 95 °C for 5 s and 60 °C for 30 s. Amplification and detection of only one PCR product was confirmed by performing melting curve analysis of the amplification products at the end of each PCR. After the PCR program, the expression level of different genes was analysed using the comparative CT method (2 - △ △ CT method) [79].

Availability of supporting data

The sequence datasets supporting the results of this article are available from the Short Read Archive (SRA) database at NCBI under the accession SRP052597.


2nd PUC Biology Sexual Reproduction in Flowering Plants NCERT Text Book Questions and Answers

Question 1.
Name the parts of an angiosperm flower in which the development of male and female gametophyte takes place.
Answer:
Development of male gametophyte takes place from microspore or pollen grains which develop inside the microsporangium or pollen sac of an anther.
Development of female gametophyte takes place in the nucellus of the ovule.

Question 2.
Differentiate between microsporogenesis and megasporogenesis. Which type of cell division occurs during these events? Name the structure formed at the end of these two events.
Answer:
The development of microspore from the microspore mother cell is called microsporogenesis. The development of the megaspore from the megaspore mother cell is called megasporogenesis. In both these developments, the mother cell undergoes meiotic division or reduction division to produce spores. At the end of these divisions, microspores or pollen grains are produced inside the pollen sac, and megaspores are produced inside the ovary.

Question 3.
Arrange the following terms in the correct developmental sequence. Pollen grain, sporogenous tissue, microspore tetrad, pollen mother cell, male gamete.
Answer:
Sporogenous tissue – pollen mother cell – microspore tetrad – pollen grains – male gametes.

Question 4.
With a neat and labelled diagram, describe the parts of a typical angiosperms ovule.
Answer:
An ovule is a female megasporangium where the formation of megaspores takes place.


The various parts of an ovule are:

  • A small stalk or funicle by which the ovule remains attached with the placenta of the ovary.
  • Hilum is the point at which it is attached with the ovule. In the inverted ovule the funicle fuses with the main body of the ovule and is called as raphe.
  • The ovule is surrounded on all sides by two integuments but not at the apex where an aperture called micropyle is present. This end of the ovule is called a micropylar, while the end of the ovule opposite to it is called a chalazal end.
  • The embryo sac is situated inside the nucellus.
  • Towards the micropyle end of the embryosac, one egg or oospore and two synergids are found, and towards the chalaza end of embryosac, three antipodal cells are found. At the center secondary nuclei are found.

Question 5.
What is meant by the monosporic development of female gametophyte?
Answer:
In many flowering plants, only one out of the four megaspores enlarges and develops into a female gametophyte or embryo sac. The other three megaspores degenerate. This type of embryo sac formation is called a monosporic type of development.

Question 6.
With a neat labelled diagram, explain the 7 celled, 8 nucleate nature of the female gametophyte.
Answer:

Embryo sac is an oval multicellular structure. It is covered by a thin membrane derived from the parent megaspore wall. The typical or Polygonum type of embryo sac contains 8 nuclei but 7 cells – 3 micropylar, 3 chalazal and one central. The three micropylar cells are collectively known as egg apparatus. One cell is larger and is called egg or oosphere. It bears a central or micropylar vacuole and a nucleus towards the chalazal end. The remaining two cells are called synergids or help cells.

Each of them bears a filiform apparatus in the micropylar region, a lateral hook, chalazal vacuole and a central nucleus. The egg or oosphere represents the single female gamete of the embryo sac. The synergids help in obtaining nourishment from the outer nucellar cells, guide the path of pollen tube by their secretion and function as shock absorbers during the penetration of the pollen tube into the embryo sac.

The three chalazal cells of the embryo sac are called antipodal cells. They are the vegetative cells of the embryo sac which may degenerate soon or take part in absorbing nourishment from the surrounding nucellar cells. Internally, they are connected with central cell by means of plasmodesmata.

The central cell is the largest cell of the embryo sac. It has a highly vacuolated cytoplasm which is rich in reserve food and Golgi bodies. In the middle, the cell contains two polar nuclei which often fuse to form a single diploid secondary nucleus. Thus, all the cells of the embryo sac are haploid except the central cell which becomes diploid due to fusion of polar nuclei.

Question 7.
What are chasmogamous flowers? Can cross-pollination occur in cleistogamous flowers? Give a reason for your answer.
Answer:
Chasmogamous flowers are the normal type of flowers, which are similar I to flowers of other species with exposed anthers and stigma, usually found in Commelina. Naturally, cross-pollination cannot occur in cleistogamous flowers because they are usually seen below the soil surface.

Question 8.
Mention two strategies evolved to prevent self-pollination in flowers.
Answer:
Continued self-pollination results in inbreeding depression. So flowering plants have developed the following devices to discourage self-pollination and to encourage cross-pollination:

  1. Dicliny (unisexuality): Flowers are unisexual so that self-pollination is not possible. The plants may be monoecious (bearing both male and female flowers, e.g., maize) or dioecious (bearing male and female flowers on different plants, e.g., mulberry, papaya).
  2. Dichogamy: Anthers and stigmas mature at different times in a bisexual flower so as to prevent self-pollination.
  • Protandry – Anthers mature earlier than the stigma of the same flower. Their pollen grains become available to stigmas of the older flowers,
    e.g., sunflower, Salvia.
  • Protogyny – Stigmas mature earlier so that they get pollinated before the anthers of the same flower develop pollen grains, e.g., Mirabilis jalapa (four o’clock), Gloriosa, Plantago.

Question 9.
What is self-incompatibility? Why does self-pollination not lead to seed formation in self-incompatible species?
Answer:
In some flowers, the pollen grains do not germinate on the pistil of the same flower. This is called self-incompatibility. In such cases, the pollen grains do not germinate and produce male gametes and hence fertilisation does not occur. So seeds are not produced in self-incompatible flowers.

Question 10.
What are bagging techniques? How is it useful in a plant breeding programme.
Answer:
If the female parent bears bisexual flowers, removal of anthers from the flower bud before the anther dehisces using a pair of forceps is necessary. This step is referred to as emasculation. Emasculated flowers have to be covered with a bag of suitable size, generally made up of butter paper, to prevent contamination of its stigma with unwanted pollen. This process is called bagging. When the stigma of the bagged flower attains receptivity, mature pollen grains collected from anthers of the male parent are dusted on the stigma, and the flowers are rebagged, and the fruits allowed to develop. This process allows plant breeders to use desired varieties of pollen to obtain desired seeds.

Question 11.
What is triple fusion? Where and how does it take place? Name the nuclei involved in triple fusion.
Answer:
One of the male gametes fuses with the secondary nucleus is called triple fusion. It takes place in the embryo sac. After the normal fertilization i.e., syngamy, (fusion of male gamete with egg), the other male gamete fuses with secondary nucleus or endosperm nucleus. The nuclei involved in triple fusion are the secondary nucleus or endosperm nucleus. They are diploid

Question 12.
Why do you think the zygote is dormant for some time in a fertilized ovule?
Answer:
Fertilised egg is known as zygote which gives rise to embryo. Before development, the zygote undergoes a resting period. This is because the zygote waits for the formation of certain amount of endosperm for the nourishment of embryo. This is an adaptation to provide assured nutrition to the developing embryo.

Question 13.
Differentiate between
(a) Hypocotyl and epicotyl
(b) Coleoptile and coleorhiza
(c) Integument and testa
(d) Perisperm and pericarp
Answer:
(a) Hypocotyl and epicotyl

Hypocotyl Epicotyl
1. The portion of the embryonal axis which lies below the cotyledon in a dicot embryo is known as hypocotyl.
2. It terminates with the radicle.
1. The portion of the embryonal axis which lies above the cotyledon in a dicot embryo is known as epicotyl.
2. It terminates with the plumule.

(b) Coleoptile and coleorhiza

Coleoptile Coleorhiza
It is a conical protective sheath that encloses the plumule in a monocot seed. It is an undifferentiated sheath that encloses the radicle and the root cap in a monocot seed.

Integument Testa
It is the outermost covering of an ovule. It provides protection to it. It is the outermost covering of a seed.

Perisperm Pericarp
It is the residual nucellus which persists. It is present in some seeds such as beet. It is the ripened wall of a fruit, which develops from the wall of an ovary.

Question 14.
Why is apple called a false fruit? Which part(s) of the flower forms fruit?
Answer:
Most fruits develop only from the ovary and are called true fruits. When fruit develops from other floral parts other than ovary it is called false fruit. Apple is a false fruit where the thalamus contributes to fruit formation.

Question 15.
What is meant by emasculation? When and why does a plant breeder employ this technique?
Answer:
It is the removal of anthers before anthesis from the bisexual flower which is used as a female parent. During hybridization, the plant breeder uses this technique to prevent self-pollination.

Question 16.
If one can induce parthenocarpy through the application of growth substances, which fruits would you select to induce parthenocarpy and why?
Answer:
Parthenocarpic fruits are fruits which develop without fertilisation and hence are seedless. Parthenocarpy can be induced through the application of growth hormones. Important fruits like banana, papaya, orange, grapes, guava, watermelon etc. can be made seedless by applying growth substances as they are economically important fruits and if made seedless they will be more valuable.

Question 17.
Explain the role of the tapetum in the formation of pollen grain walls.
Answer:
Tapetum is the innermost layer of microsporangium. It provides nourishment to the developing pollen grains. During microsporogenesis, the cells of the tapetum produce various enzymes, hormones, amino acids, and other nutritious material required for the development of pollen grain. It also produces the exine layer of the pollen grains, which is composed of sporopollenin.

Question 18.
What is apomixis and what is its importance?
Answer:
Normal type of sexual reproduction having two regular features i.e., meiosis and fertilisation is called amphimixis. But in some plants, this normal sexual reproduction is replaced by some abnormal type of sexual reproduction called apomixis.

The term apomixis was first given by Winkler (1908). Apomixis may be defined as, abnormal kind of sexual reproduction in which an egg or other cells associated with an egg (synergids, antipodals, etc.) develop into an embryo without fertilisation and with or without meiosis. Hybrid varieties of several food and vegetable crops are being extensively cultivated. The cultivation of hybrids tremendously increased productivity.

One of the problems of hybrids is that hybrid seeds have to be produced every year. If the seeds collected from hybrids are sown, the plants in the progeny will segregate and do not maintain hybrid characters. Production of hybrid seeds is costly and hence the cost of hybrid seeds becomes too expensive for the farmers. If these hybrids are made into apomicts, there is no segregation of characters in the hybrid progeny. Then the farmers can keep on using the hybrid seeds to raise new crops year after year and do not have to buy hybrid seeds every year. Embryos formed through apomixis are generally free from infections.

2nd PUC Biology Sexual Reproduction in Flowering Plants Additional Questions and Answers

2nd PUC Biology Sexual Reproduction in Flowering Plants One Mark Questions

Question 1.
Find the odd one out
b. Endothecium, Tapetum, Middle layers, Nucellus
c. Exine, Tube nucleus, Synergids, Generative cell
d. Egg, Intine, Antipedals, Secondary nucleus
Answer:
b. Nucellus
c. Synergids
d. Intine

Question 2.
Name some water-pollinated plats.
Answer:

Question 3.
Some flowers are highly modified for insect pollination. They have many features which help this kind of pollination.
a. What are these flowers called?
b. Explain the characters which make them suitable for this type of pollination.
Answer:
a. Entamophilous flowers
b. Brightly coloured, fragrant, nectary, sticky pollen grains.

Question 4.
What is a false fruit? Give an example.
Answer:
The fruit is formed by any floral parts of the flower other than the ovary, eg. apple, pear, cashew nut, etc. [CBSE – 95]

Question 5.
Angiosperms produce male and female reproductive structures in which male and female gametophytes and gametes are produced.
a. Name the male and female reproductive structure.
b. Name the male and female gametophytes.
Answer:
a. The male reproductive structure is another and the female reproductive structure is the pistil.
b. The male gametophyte is the mature pollen grain and the female gametophyte is embryosac.

Question 6.
Which nuclei fuse to give endosperm?
Answer:
Polar nuclei.

Question 7.
Name the stage of the occurrence of more than one embryo in a seed.
Answer:
Polyembryony.

Question 8.
The term for the early stages of embryo development.
Answer:
Embryogeny

Question 9.
The formation of the primary endosperm nucleus is called triple fusion. Why is it called so?
Answer:
The primary endosperm nucleus is formed by the fusion of the secondary nucleus and a male gamete and the secondary nucleus is formed by the fusion of two haploid polar nuclei. As three fusions are taking place in the formation of the primary endosperm nucleus, it is called triple fusion.

Question 10.
Define parthenocarpy.
Answer:
These are seedless fruits which are formed without pollination and fertilization.

Question 11.
What is fertilization?
Answer:
It is the fusion of one male gamete with the egg cell and a second gamete with polar nuclei in angiosperm. [CBSE – 99]

Question 12.
State the difference between the endosperm of gymnosperms and angiosperms.
Answer:
The endosperm of gymnosperms is haploid gametophyte but in angiosperms, it is triploid as it is formed after double fertilization.

Question 13.
What is epicotyl?
Answer:
A portion of an embryonic axis between the plumule and cotyledon.

Question 14.
Define the term geitonogamy.
Answer:
A condition where pollen from one flower deposited on the stigma of another flower borne on the same plant.

Question 15.
What is the fate of the secondary nucleus after fertilization?
Answer:
It forms the endosperms.

Question 16.
What is allogamy?
Answer:
It is the transfer of pollen from one flower to the stigma of another flower on a separate plant of the same species.

Question 17.
What develops into a microspore mother cell in a flower?
Answer:
Sporogenous cells.

Question 18.
What is coleorrhiza ? [CBSE – 97]
Answer:
It is the protective cap over the radicle of maize.

Question 19.
What is scutellum?
Answer:
It is the single cotyledon of maize.

Question 20.
What is funiculus?
Answer:
The stalk of the ovule by which it is attached to the placenta.

2nd PUC Biology Sexual Reproduction in Flowering Plants Two Marks Questions

Question 1.
Differentiate between parthenocarpy and parthenogenesis.
Answer:
Parthenocarpy is .the formation of fruit without fertilization whereas parthenogenesis is the formation of an embryo from an unfertilized egg.

Question 2.
Draw a labelled diagram of the mature pollen grain. [CBSE – 90]
Answer:

Question 3.
What is seed dormancy? Give any 2 advantages. [CBSE – 94]
Answer:
Seed dormancy is the condition of the seed when it fails to germinate even though the environmental conditions are favorable for active growth.
Two advantages of dormancy:

  • It helps the seed to disseminate in time and space in order to achieve a maximum cooperative environment for the survival of species.
  • To ensure successful seed germination under the most favourable conditions.

Question 4.
What are false fruits? Give example.
Answer:
The fruits which develop from parts other than ripened ovary are called false fruits.
Eg: fruits of apple and pear develop from the fleshy thalamus. [CBSE – 95]

Question 5.
Write the significance of double fertilization.
Answer:
Double fertilization leads to the development of triploid endosperm which provides nourishment to the developing healthy seed and this triploid endosperm compensates for the extreme reduction of female gametophyte in angiosperms.

Question 6.
Arrange the following terms in a correct developmental sequence.
Pollen grain, sporogenous tissue, microspore tetrad, pollen mother cell, male gametes.
Answer:
The correct development sequence for the above terms is sporogenous tissue, microspore tetrad, pollen mother cell, pollen grain, male gametes.

Question 7.
Write the difference between coleoptile and coleorhiza.
Answer:

  • In the monocot seed, the region of the embryonic axis below the cotyledon is the radicle covered with a protective sheath is coleorhiza.
  • Above the point of attachment of the cotyledon, the embryonic axis becomes the plumule which is enclosed by a leaf-like covering called coleoptile.

2nd PUC Biology Sexual Reproduction in Flowering Plants Five Marks Questions

Question 1.
Describe the process of development of a dicotyledonous embryo.
Answer:
The process of development of a mature embryo from a diploid zygote is called embryogenesis. After fertilization, the zygote of the ovule divides transversely into two cells – a small apical cell and a large basal cell. The basal cell lying towards the micropyle divides in one direction into a row of cells called a suspensor. It pushes the developing embryo into the endosperm for the absorption of nutrients.

The apical cell located towards the antipodal end of the zygote undergoes two vertical divisions and one transverse division to form the embryonal mass. The cells of the embryonal mass divide repeatedly and the various parts of the embryo are formed. The anterior cells of the embryonal mass form plumule and two cotyledons. The main part of the radicle and the hypocotyl are formed from the posterior embryonal mass cells.

Question 2.
Trace the events that would take place in a flower from the time the pollen grain of the same species falls on the stigma up to the completion of fertilization.
Answer:

The pollen grain develops on the stigma stimulated by the secretion of the stigma. The intine grows out as a protuberance through one of the germ pores. This outgrowth continues to grow as a pollen tube. The nucleus of the vegetative cell moves into it followed by the generative cell. The generative cell divides into two male gamete and moves to the tip of the pollen tube.

The pollen tube secretes enzymes to digest the tissues of the style and enters the ovule through the micropylar end and discharges the two male gametes into one of the synergies of the embryo sac. One of the male gametes fuses with the ovum to form a zygote. This process is called syngamy. The other male gamete fuses with the secondary nucleus to form the primary endosperm nucleus.

This process is called triple fusion. Since there are two fusions (syngamy and triple fusion) inside the ovule during fertilization, it is known as double fertilization.

Question 3.
Draw a labelled diagram of a T.S of a dehisced anther.
Answer:

Question 4.
The flower of brinjal is referred to as chasmogamous while that of beans is cleistogamous. How are they different from each other?
Answer:

  • Chasmogamous flowers: Chasmogamous flowers are similar to flowers of other species with exposed anthers and stigma.
  • Cleistogamous flowers: Cleistogamous flowers never open to ensure self-pollination. They remain closed so that cross-pollination does not occur.

Three cells are grouped at the clealazal end they are called antipodals. The large cell in the centre of the embryo sac is the central cell. Later 2 polar nuclei in the centre cell fused to form a depolid secondary nucleus or endosperm nucleus. Thus the embryo sac of flowering plants is 8 nucleate 7 celled at maturity. This type of embryo sac is called monosporic because it is formed from only one of the 4 megaspores.


NCERT Exemplar Problems Class 12 Biology Chapter 2 Sexual Reproduction in Flowering Plants

Multiple Choice Questions
Single Correct Answer Type
Question.1. Among the terms listed below, those that are of not technically correct names for a floral whorl are
i. Androecium ii. Carpel
iii. Corolla iv. Sepal
(a) i and iv (b) iii and iv
(c) ii andiv (d) i and ii
Answer. (c)
• There are 4 floral whorls viz., calyx, corolla, androecium and gynoecium. Calyx and corolla are accessory organs or non-essential whorl, while androecium and gynoecium are reproductive organs.
• The calyx is the outermost whorl of the flower and the members are called sepals.
• Gynoecium is the female reproductive part of the flower and is made up of one or more carpels.

Question.2. Embryo sac is to ovule as is to an anther.
(a) Stamen .(b) Filament
(c) Pollen grain (d) Androecium
Answer. (c)
• Embryo sac (female gametophyte) • Ovule (megasporangium)
• Pollen grain (male gametophyte) • Anther (microsporangium)

Question.3. In a typical complete, bisexual and hypogynous flower, the arrangement of floral whorls on the thalamus from the outermost to the innermost is
(a) Calyx, corolla, androecium and gynoecium
(b) Calyx, corolla, gynoecium and androecium
(c) Gynoecium, androecium, corolla and calyx
(d) Androecium, gynoecium, corolla and calyx
Answer. (a) Arrangement of floral whorls on the thalamus from the outermost to the innermost is calyx, corolla, androecium and gynoecium.

Question.4. A dicotyledonous plant bears flowers but never produces fruits and seeds. The most probable cause for the above situation is
(a) Plant is dioecious and bears only pistillate flowers
(b) Plant is dioecious and bears both pistillate and staminate flowers
(c) Plant is monoecious
(d) Plant is dioecious and bears only staminate flowers.
Answer. (d) A dicotyledonous plant bears flowers but never produces fruits and seeds because plant is dioecious and bears only staminate flowers.

Question.5. The outermost and innermost wall layers of microsporangium in an anther are respectively
(a) Endothecium and tapetum (b) Epidermis and endodermis
(c) Epidermis and middle layer (d) Epidermis and tapetum
Answer. (d) Wall layers of microsporangium in an anther are:

Question.6. During microsporogenesis, meiosis occurs in
(a) Endothecium (b) Microspore mother cells
(c) Microspore tetrads (d) Pollen grains
Answer. (b) During microsporogenesis, meiosis occurs in microspore mother cells.

Question.7. From among the sets of terms given below, identify those that are associated with the gynoecium.
(a) Stigma, ovule, embryo sac, placenta
(b) Thalamus, pistil, style, ovule
(c) Ovule, ovary, embryo sac, tapetum
(d) Ovule, stamen, ovary, qpibryo sac
Answer. (a) Stigma, ovule, embryo sac and placenta are associated with the gynoecium.

Question.8. Starting from the innermost part, the correct sequence of parts in an ovule are
(a) Egg, nucellus, embryo sac, integument .
(b) Egg, embryo sac, nucellus, integument.
(c) Embryo sac, nucellus, integument, egg
(d) Egg, integument, embryo sac, nucellus
Answer. (b) The correct sequence of parts in an ovule are

Question.9. From the statements given below, choose the option that are true for a typical female gametophyte of a flowering plant.
i. It is 8-nucleate and 7-celled at maturity
ii. It is free-nuclear during the development
iii. It is situated inside the integument but outside the nucellus
iv. It has an egg apparatus situated at the chalazal end
(a) i and iv (b) ii and iii
(c) i and ii (d) ii and iv
Answer. (c) A typical female gametophyte of a flowering plant is 8-nucleate and 7-celled at maturity and free-nuclear during the development.

Question.10. Autogamy can occur in a chasmogamous flower if
(a) Pollen matures before maturity of ovule
(b) Ovules mature before maturity of pollen
(c) Both pollen and ovules mature simultaneously
(d) Both anther and stigma are of equal lengths
Answer. (c) In a normal flower which opens and exposes the anthers and stigma complete autogamy is rather rare. Autogamy in such flowers requires synchrony in pollen release and stigma receptivity and also, the anthers and the stigma should lie close to each other so that self-pollination can occur.

Question.11. Choose the correct statement from the following:
(a) Cleistogamous flowers always exhibit autogamy
(b) Chasmogamous’flowers always exhibit geitonogamy
(c) Cleistogamous flowers exhibit both autogamy and geitonogamy
(d) Chasmogamous flowers never exhibit autogamy
Answer. (a) Cleistogamous flowers are invariably autogamous as there is no chance of cross-pollen landing on the stigma. Cleistogamous flowers produce assured seed-set even in absence of pollinators.
E.g. of cleistogamous flowers are Viola (common pansy), Oxalis, Commelina, Arachis hypogea and Oryza sativa.

Question.12. A particular species of plant produces light, non-sticky pollen in large numbers and its stigmas are long and feathery. These modifications facilitate pollination by
(a) Insects (b) Water (c) Wind (d) Animals
Answer. (c) Pollination by wind is called anemophily. Anemophilous flowers are small, in conspicuous non-scented without bright colours, nectar and fragrance. Wind pollination also requires that the pollen grains are light and non-sticky which is in large numbers and its stigmas are long and feathery.

Question.13. From among the situations given below, choose the one that prevents both autogamy and geitonogamy.
(a) Monoecious plant bearing unisexual flowers
(b) Dioecious plant bearing only male or female flowers
(c) Monoecious plant with bisexual flowers
(d) Dioecious plant with bisexual flowers
Answer. (b)
• Autogamy (same flower) geitonogamy (different flowers of same plants xenogamy (different plant’s flower)
• Dioecious plant bearing only male or female flowers prevents both autogamy and geitonogamy.

Question.14. In a fertilised embryo sac, the haploid, diploid and triploid structures are
(a) Synergid, zygote and primary endosperm nucleus
(b) Synergid, antipodal and polar nuclei
(c) Antipodal, synergid and primary endosperm nucleus
(d) Synergid, polar nuclei and zygote
Answer. (a) In a fertilised embryo sac, the haploid, diploid and triploid structures are synergid, zygote and primary endosperm nucleus, respectively.

Question.15. In an embryo sac, the cells that degenerate after fertilisation are
(a) Synergids and primary endosperm cell
(b) Synergids and antipodals
(c) Antipodals and primary endosperm cell
(d) Egg and antipodals
Answer. (b) In an embryo sac, synergids and antipodals degenerate after fertilisation.

Question.16. While planning for an artificial hybridization programme involving dioecious plants, which of the following steps would not be relevant?
(a) Bagging of female flower
(b) Dusting of pollen on stigma
(c) Emasculation
(d) Collection of pollen
Answer. (c)
• Artificial hybridisation is one of the major approaches of crop improvement programme. In such crossing experiments it is important to make sure that only the desired pollen grains are used for pollination and the stigma is protected from contamination (from unwanted pollen). This is achieved by emasculation and bagging techniques.
• Emasculation is relevant in monoecious plants.

Question.17. In the embryos of a typical dicot and a grass, true homologous structures are
(a) Coleorhiza and coleoptile
(b) Coleoptile and scutellum
(c) Cotyledons and scutellum
(d) Hypocotyl and radicle
Answer. (c) Cotyledons of the typical dicot embryo are simple structures generally thick and swollen due to storage of food reserves (as in legumes) and embryo of monocots consists of one large and shield shaped cotyledon known as scutellum situated towards one side (lateral) of the embryonal axis. E.g.: Grass family, Sorghum.

Question.18. The phenomenon observed in some plants wherein parts of the sexual apparatus is used for forming embryos without fertilisation is called
(a) Parthenocarpy (b) Apomixis
(c) Vegetative propagation (d) Sexual reproduction
Answer. (b)
• Apomixis is the special mechanism, to produce seed without fertilisation. It is observed in few flowering plants such as some species of asteraceae and grasses.
• Apomixis is a form of asexual reproduction that mimics sexual reproduction. If a fruit is formed without fertilisation of ovary, it is called a parthenocarpic fruit, e.g., banana and grape.

Question.19. In a flower, if the megaspore mother cell forms megaspores without undergoing meiosis and if one of the megaspores develops into an embryo sac, its nuclei would be
(a) Haploid
(b) Diploid
(c) A few haploid and a few diploid
(d) With varying ploidy
Answer. (b) In a flower, if the megaspore mother cell forms megaspores without undergoing meiosis and if one of the megaspores develops into an embryo sac, its nuclei would be diploid.

Question.20. The phenomenon wherein, the ovary develops into a fruit without fertilisation is called
(a) Parthenocarpy
(b) Apomixis
(c) Asexual reproduction
(d) Sexual reproduction’
Answer. (a) If a fruit is formed without fertilisation of ovaty, it is called a parthenocarpic fruit, e.g., banana and grape.

Very Short Answer Type Questions
Question.1. Name the component cells of the ‘egg apparatus’ in an embryo sac.
Answer. Egg apparatus have three cells—one egg cell and two synergids.

Question.2. Name the part of gynoecium that determines the compatible nature of pollen grain.
Answer. Compatible nature of pollen grain is determined by the stigma of carpel/ pistil.

Question.3. Name the common function that cotyledons and nucellus perform.
Answer. Both cotyledons and nucellus provide nourishment.

Question.4.Complete the following flow chart:

Answer.

Question.5.Indicate the stages where meiosis and mitosis occur (1, 2 or 3) in the flow ?

Answer.

Question.6. In the diagram given below, show the path of a pollen tube from the pollen on the stigma into the embryo sac. Name the components of egg apparatus.

Answer. Components of egg apparatus: one egg cell and two synergids.

Question.7. Name the parts of pistil which develop into fruit and seeds.
Answer. Ovaiy of pistil develops into fruit while ovules develop into seeds.

Question.8.In case of polyembryony, if an embryo develops from the synergid and another from the nucellus which is haploid and which is diploid?
Answer.Synergid embryo is haploid and nucellar embryo is diploid.

Question.9.Can an unfertilised, apomictic embryo sac give rise to a diploid embryo? If yes, then how?
Answer.Yes, if the embryo develops from the cells of nucellus or integument it will be diploid.

Question.10.Which are the three cells found in a pollen grain when it is shed at the three- celled stage?
Answer.One vegetative cell and two male gametes.

Question.11.What is self-incompatibility?
Answer.The device to prevent inbreeding is self-incompatibility or self-sterlity. This is a genetic mechanism and prevents self-pollen (from the same flower or other flowers of the same plant) from fertilising the ovules by inhibiting pollen germination or pollen tube growth in the pistil.

Question.12.Name the type of pollination in self-incompatible plants.
Answer.Xenogamy

Question.13.Draw the diagram of a mature embryo sac and show its 8-nucleate, 7-celled nature. Show the following parts: antipodals, synergids, egg, central cell, polar nuclei.
Answer.

Question.14. Which is the triploid tissue in a fertilised ovule? How is the triploid condition achieved?
Answer. The triploid tissue in the ovule is the endosperm. Its triploid condition is . attained due to the fusion of two polar nuclei and one nucleus of male gamete (also referred to as triple fusion).

Question.15. Are pollination and fertilization necessary in apotnixis? Give reasons.
Answer. No, they are not necessary. Apomixis is actually an alternative to sexual
reproduction although the female sexual apparatus is used in the process. In apomicts, embryos can develop directly from the nucellus or synergid or egg. Therefore, there is no need for either pollination or fertilisation.

Question.16.Identify the type of carpel with the help of diagrams given below:

Answer.

Question.17. How is pollination carried out in water plants?
Answer. Pollination by water is called hydrophily. Some examples of water pollinated plants are Vallisneria and Hydrilla (both are angiospermic hydrophytes) which grow in fresh water and several marine sea-grasses such as Zostera. Not all aquatic plants use water for pollination. In a majority of aquatic plants such as water hyacinth and water lily, the flowers emerge above the level of water and pollinated by insects or wind as in most of the land plants.

Question.18. What is the function of the two male gametes produced by each pollen grain in angiosperms?
Answer. After entering one of the synergids, the pollen tube releases the two male gametes into the cytoplasm of the synergid. One of the male gametes moves towards the egg cell or oosphere and fuses with its nucleus, thus completing the syngamy. This results in the formation of a diploid cell, the zygote. The other male gamete moves towards the two polar nuclei located in the central cell and fuses with them to produce a triploid primary endosperm nucleus (PEN).

Short Answer Type Questions
Question.1. List three strategies that a bisexual chasmogamous flower can evolve to prevent self-pollination (autogamy).
Answer. Flowering plants have developed many devices to discourage self-pollination and to encourage cross-pollination.
• First device: In some species, pollen release and stigma receptivity are not synchronised. Either the pollen is released before the stigma becomes receptive or stigma becomes receptive much before the release of pollen. This condition is called dichogamy in which stigma and anther matures at different time.
• Second device: In some species, the anther and stigma are placed at different positions so that the-pollen cannot come in contact with the stigma of the same flower. This condition is called heterostyly.
• Herkogamy: Non-transfer of pollen from anther to stigma of the same flower due to a mechanical barrier is present between anther and stigma. E.g.: Calotropis (Asclepiadaceae), Aristolochia, Gloriosa superba.
The third device to prevent inbreeding is self-incompatibility or self-sterility. This is a genetic mechanism and prevents self-pollen (from the same flower or other flowers of the same plant) from fertilising the ovules by inhibiting pollen germination or pollen tube growth in the pistil.

Question.2. Given below are the events that are observed in an artificial hybridization programme. Arrange them in the correct sequential order in which they are followed in the hybridisation programme.
(a) Re-bagging, (b) Selection of parents, (c) Bagging, (d) Dusting the pollen on stigma, (e) Emasculation, (f) Collection of pollen from male parent.
Answer. (b) Selection of parents –>(e) Emasculation —> (c) Bagging –> (f) Collection of pollen from male parent –>(d) Dusting the pollen on stigma –>(e) Rebagging.

Question.3. Vivipary automatically limits the number of offspring in a litter. How?
Answer. In viviparous animals (majority of mammals including human beings), the
zygote develops into a young one inside the body of the female organism. After attaining a certain stage of growth, the young ones are delivered out of the body of the female organism. Vivipary automatically limits the number of offspring in a litter because female have limited space for the development of embryo.

Question.4. Does self-incompatibility impose any restrictions on autogamy? Give reasons and suggest the method of pollination in such plants.
Answer. Self-incompatibility imposes restriction to autogamy. The device to prevent inbreeding is self-incompatibility or self-sterility. This is a genetic mechanism and prevents self-pollen (from the same flower or other flowers of the same plant) from fertilising the ovules by inhibiting pollen germination or pollen tube growth in the pistil. Self-incompatiblity is overcome by mixed pollination.

Question.5. In the given diagram, write the names of parts shown with lines.

Answer.

Question.6. What is polyembryony and how can it be commercially exploited?
Answer. As in many Citrus and Mango varieties some of the nucellar cells surrounding the embryo sac start dividing, protrude into the embryo sac and develop into the embryos. In such species each ovule contains many embryos. Occurrence of more than one embryo in a seed is referred as polyembryony.
If hybrids are made into apomicts, there is no segregation of characters in the hybrid progeny. Then the farmers can keep on using the hybrid seeds to raise new crop year after year and he does not have to buy hybrid seeds every year.

Question.7. Are parthenocarpy and apomixis different phenomena? Discuss their benefits.
Answer. Yes, they are different. Parthenocarpy leads to development of seedless fruits.
Apomixis leads to embryo development.

Question.8. Why does the zygote begin to divide only after the division of Primary Endosperm Cell (PEC)?
Answer. The zygote needs nourishment during its development. As the mature, fertilised embryo sac offers very little nourishment to the zygote, the PEC divides and generates the endosperm tissue which nourishes the zygote. Hence, the zygote always divides after division of PEC.

Question.9. The generative cell of a two-celled pollen divides in the pollen tube but not in a three-celled pollen. Give reasons.
Answer. In a 3-celled pollen, as the generative cell has already been divided and formed 2 male gametes, it will not divide again in the pollen tube. But in a 2-celled pollen, as the generative cell has not divided, it divides in the pollen tube.

Question.10. In the figure given below, label the following parts: male gametes, egg cell, polar nuclei, synergid and pollen tube

Answer.

Long Answer Type Questions
Question.1. Starting with the zygote, draw the diagrams of the different stages of embryo development in a dicot.
Answer.

Question.2. What are the possible types of pollinations in chasmogamous flowers? Give reasons.
Answer. A bisexual flower which normally open is called chasmogamous flower.
Kinds of Pollination
1. Autogamy: In this type, pollination is achieved within the same flower. Transfer of pollen graift from the anther to the stigma of the same flower. In a normal flower which opens and exposes the anthers and stigma complete autogamy is rather rare.
Majority of flowering plants produce hermaphrodite flowers and pollen grains are likely to come in contact with the stigma of the same flower. Continued self-pollination result in inbreeding depression. Flowering plants have developed many devices to discourage self-pollination and to encourage cross-pollination.
2. Geitonogamy: Transfer of pollen grains from the anther to the stigma of another flower of the same plant.
3. Xenogamy: Transfer of pollen grains from anther to the stigma of a different plant.

Question.3. With a neat, labelled diagram, describe the parts of a mature angiosperm embryo sac. Mention the role of synergids.
Answer.

Filiform apparatus present at the micropylar part of the synergids guides the entry of pollen tube.

Question.4. Draw the diagram of a microsporangium and label its wall layers. Write briefly on the role of the endothecium.
Answer.

Endothecium performs the function of protection and help in dehiscence of anther to release the pollen.

Question.5. Embryo sacs of some apomictic species appear normal but contain diploid cells. Suggest a suitable explanation for the condition.
Answer. It is true that many apomicts possess normal looking embryo sacs. The only possibility of the embryo sac possessing diploid cells is due to failure of meiotic division at the megaspore mother cell stage. Since, the megaspore mother cell has a diploid nucleus, if it undergoes mitosis instead of meiosis, all the resulting nuclei and cells will be diploid in nature.


DISCUSSION

Our results suggest environmental control of phenology and differential resource allocation depending on the amount of pollen received in the cleistogamous R. nudiflora. Under shaded conditions, production of CH flowers was for a shorter period and the production of CH fruit ended earlier, whilst shade induced an earlier start to CL fruit production. However, the total numbers of CH flowers and all fruit (CH and CL) were not affected by shade. Regarding biomass allocation to seeds, sub-optimal (shaded) conditions, but not unshaded conditions, favoured allocation to CH seeds receiving pollen supplementation. These results suggest that under sub-optimal conditions, not only are resources re-allocated to produce CL structures earlier, but also plants re-allocate biomass mainly to CH seeds that developed from CH flowers receiving larger pollen loads. Thus, the cleistogamous R. nudiflora responds to sub-optimal conditions with two contrasting strategies: earlier production of CL seeds and greater biomass allocation to presumably higher quality CH seeds.

Although we did not find any effect of shade or watering on the number of CH flowers, CH fruit and CL fruit, we did identify an effect of shade on the phenology of all these structures, though on different aspects. As a response to shade, the production of CH flowers was shortened and the production of CH fruit finished earlier relative to plants in open sub-plots. On the other hand, CL fruit (and, therefore, CL flowers) were produced earlier in plants under shaded conditions than in those plants in open sub-plots. In contrast to previous studies reporting that sub-optimal conditions increase the production of CL flowers relative to CH flowers ( Culley and Klooster, 2007), our results have shown that R. nudiflora produces a similar number of CH and CL flowers or fruit regardless of environmental conditions instead, temporal patterns of CH and CL flower and fruit production are differentially influenced by light availability. An earlier production of CL flowers (and subsequently fruit) and a shorter period of production of CH flowers may be advantageous under shaded conditions even if the total number of flowers or fruit remains constant. Ruellia nudiflora starts its reproduction with CL flowers followed by production of CH flowers, and produces CL flowers once again at the end of the reproductive season. This sequence was not affected by water or light availability therefore, an earlier production of CL flowers and fruit actually represents an earlier start of the reproductive season. Earlier flowering is usually positively correlated with reproductive success in plants ( Munguía-Rosas et al., 2011) and this might be the case for our study species. On the other hand, a shorter period of production of CH flowers under shaded conditions, but in a similar quantity to those under more optimal conditions, may favour pollinator attraction, and therefore pollination success, because a larger floral display is presented. Our study also showed that R. nudiflora allocates more resources to flowers receiving larger pollen loads, and this could result in more vigorous and potentially more successful progeny in sub-optimal environments. This work reveals the importance of looking at fine scale changes in the phenology of CH and CL flowers and fruits using suitable quantitative methods. Up to now, previous studies looking at phenology of cleistogamous plants had focused only on the total production of CH and CL flowers or on qualitative temporal patterns (e.g. Jasieniuk and Lechowicz, 1987 Sigrist and Sazima, 2002 Imaizumi et al., 2008) and were unable to detect small variations in phenology in response to environmental variables.

It has been suggested that annual and perennial cleistogamous plants differ in their reproductive phenology ( Oakley et al., 2007). According to these authors, in annuals CL structures are produced first (in some cases also at the end), followed by simultaneous production of CL and CH. In contrast, perennials usually sequentially produce CH and CL structures in some cases, the production of CL structures occurs after CH but never before ( Oakley et al., 2007). Ruellia nudiflora does not follow the pattern predicted for perennials: invariably CL structures are produced first, regardless of environmental conditions. Although some previous studies showed that soil moisture affects production of CH and CL flowers (e.g. Bell and Quinn, 1987), we did not identify any effect of watering on phenology or resource allocation. Our experiment was conducted under field conditions and therefore some limitations exist, such as the inability to avoid or reduce natural rainfall over specific sub-plots without disturbing light availability. Even so, we know that non-watered sub-plots were under sub-optimal or stressful conditions of water availability for a longer period of time than plants in watered sub-plots (Supplementary Data Fig. S2). However, we cannot rule out completely the possibility that the phenology of R. nudiflora may respond to an even stronger water deficit.

Sub-optimal (shaded) conditions affected not only the phenology of reproductive structures in R. nudiflora, but also patterns of resource allocation among CL fruit and CH fruit from flowers receiving larger pollen loads. Previous reviews have suggested that, in general, CL structures have priority over CH structures under sub-optimal conditions (e.g. Oakley et al., 2007). Under shaded conditions R. nudiflora plants allocated resources earlier to produce CL flowers and fruits however, the total number of these structures and the biomass allocated to CL seeds were not affected by shade or watering. Interestingly, our results suggest that, under sub-optimal conditions, those seeds sired from CH flowers receiving extra pollen may also be prioritized in cleistogamous plants. CL seeds, as previously suggested, may ensure reproduction under disadvantageous conditions ( Campbell et al., 1983 Culley and Klooster, 2007), but also, good-quality CH seeds may produce highly competitive seedlings under sub-optimal conditions. Sired seeds from larger pollen loads are not only heavier ( Richardson and Stephenson, 1992), but their size is also positively correlated with performance in some species ( Richardson and Stephenson, 1992 Bernard and Toft, 2007) including some cleistogamous species (e.g. Trapp and Hendrix, 1988 Berg and Redbo-Torstensson, 2000). Therefore, a superior performance of seeds sired from pollen-supplemented CH flowers is likely in R. nudiflora. Research in the study area has revealed that R. nudiflora has high genetic diversity (78 % of polymorphic loci Ortegón-Campos, 2010) and a high outrossing rate (tm = 0·9 Marrufo, UADY, Mérida, México, unpubl. res.), which suggest that it is the size of the pollen load and not the origin (i.e. selfed vs. outcrossed) that is affecting preferential resource allocation to pollen-supplemented CH flowers. Possibly plants did not allocate more resources to pollen-supplemented CH flowers in open sub-plots because these plants are not resource limited and, therefore, these plants are able to allocate resources to CH flowers equally regardless of the size of the pollen load. It is unlikely that our results in terms of resource allocation (i.e. greater allocation to pollen-supplemented CH flowers under shaded conditions) would be an artefact introduced by limitation in pollinator service due to the shade cloth. First of all, the cloth was placed about 1 m from the soil, which allowed visitors to move freely beneath the cloth as well as fly over open sub-plots. Secondly, we did not identify any effect of shade on per-seed weight as a single factor, i.e. all non-manipulated CH flowers produced seeds of similar weight in open and shaded sub-plots (Fig. 2). Previous studies have documented that when applied to a sub-set of flowers, pollen supplementation is not indicative of pollen limitation instead, it is useful to assess resource re-allocation ( Parra-Tabla et al. 1998 Knight et al., 2005, 2006).

In conclusion, our study suggests that temporal patterns in production of CH and CL structures are affected differentially by shade CL structures are produced earlier under shaded conditions whilst CH structures were produced for shorter periods. However, in addition to an earlier production of CL structures, R. nudiflora also preferentially allocates resources to those CH flowers receiving larger pollen loads. Earlier production of CL seeds and potentially more vigorous CH seeds can be a mixed strategy to face unpredictable environments if earlier production of CL structures and the size of the CH seeds are both positively correlated with subsequent success of the resulting seedling from each seed type. If this is the case, CL progeny may provide cheap reproductive assurance if environmental conditions improve. Instead, CH seeds sired from large pollen loads may be highly competitive if sub-optimal conditions persist. Since R. nudiflora is an invasive weed in Mexico ( Villaseñor and Espinosa-García, 2004 Cervera and Parra-Tabla, 2009), our results may also be useful to understand the reproductive strategies allowing invasive species to colonize new habitats ( Cheplick, 2006 Imaizumi et al., 2008). Future studies looking at the effect of environment on resource allocation in any cleistogamous plant should also consider that the size of the pollen load may produce differential allocation patterns in CH seeds. It has been suggested that cleistogamy evolved as a response to environmental heterogeneity ( Schoen and Lloyd, 1984) therefore, allocation to flowers, allocation to seeds and the performance of the progeny may produce different patterns under optimal and sub-optimal conditions.


Watch the video: 10 φυτά που αλλάζουν εντελώς τις ατμoσφαιρικές συνθήκες και δημιουργούν το ιδανικό κλίμα για το σπ (January 2022).