Information

How to isolate host cell RNA (tRNA,mRNA,rRNA) from viral RNA?


A retrovirus with RNA genome infected a host cell. You would like to isolate the host cell's RNA (rRNA, tRNA, and mRNA) from the virus RNA. What properties can you rely on to determine the three types of host cell RNA- for example, in terms of their size, complexity, GC content, or abundance in the cell? The undetermined RNA can be identified as the virus RNA.


Thermo Fisher has a protocol for the separation of host mammalian RNA from prokaryotic RNA, optimized for E. coli vs human, mouse or rat sequences. Capture oligonucleotides bind portions of the mammalian RNA and hybridize. These hybridized oligo/RNA are then removed from solution via "oligonucleotide-derivatized magnetic beads," after which the remaining RNA assumed to be from whatever prokaryote can be precipitated out w/ ethanol. If you know enough about your virus and your host, I don't see why a similar assay can't be created. Otherwise, Thermo Fisher has additional links to RNA isolation protocol… most of the viral assays, however, utilize serum, plasma, etc. because host DNA/RNA will elute along with the viral RNA if they're present, as in samples containing cells.


10.2.2: Structure and Function of RNA

  • Contributed by OpenStax
  • General Biology at OpenStax CNX
  • Describe the biochemical structure of ribonucleotides
  • Describe the similarities and differences between RNA and DNA
  • Describe the functions of the three main types of RNA used in protein synthesis
  • Explain how RNA can serve as hereditary information

Structurally speaking, ribonucleic acid (RNA), is quite similar to DNA. However, whereas DNA molecules are typically long and double stranded, RNA molecules are much shorter and are typically single stranded. RNA molecules perform a variety of roles in the cell but are mainly involved in the process of protein synthesis (translation) and its regulation.

RNA Structure

RNA is typically single stranded and is made of ribonucleotides that are linked by phosphodiester bonds. A ribonucleotide in the RNA chain contains ribose (the pentose sugar), one of the four nitrogenous bases (A, U, G, and C), and a phosphate group. The subtle structural difference between the sugars gives DNA added stability, making DNA more suitable for storage of genetic information, whereas the relative instability of RNA makes it more suitable for its more short-term functions.

Figure (PageIndex<1>): (a) Ribonucleotides contain the pentose sugar ribose instead of the deoxyribose found in deoxyribonucleotides. (b) RNA contains the pyrimidine uracil in place of thymine found in DNA.

The RNA-specific pyrimidine uracil forms a complementary base pair with adenine and is used instead of the thymine used in DNA. Even though RNA is single stranded, most types of RNA molecules show extensive intramolecular base pairing between complementary sequences within the RNA strand, creating a predictable three-dimensional structure essential for their function (Figure (PageIndex<1>) and Figure (PageIndex<2>)).

Figure (PageIndex<2>): (a) DNA is typically double stranded, whereas RNA is typically single stranded. (b) Although it is single stranded, RNA can fold upon itself, with the folds stabilized by short areas of complementary base pairing within the molecule, forming a three-dimensional structure.

How does the structure of RNA differ from the structure of DNA?

Functions of RNA in Protein Synthesis

Cells access the information stored in DNA by creating RNA to direct the synthesis of proteins through the process of translation. Proteins within a cell have many functions, including building cellular structures and serving as enzyme catalysts for cellular chemical reactions that give cells their specific characteristics. The three main types of RNA directly involved in protein synthesis are messenger RNA (mRNA), ribosomal RNA (rRNA), and transfer RNA (tRNA).

In 1961, French scientists François Jacob and Jacques Monod hypothesized the existence of an intermediary between DNA and its protein products, which they called messenger RNA. 1 Evidence supporting their hypothesis was gathered soon afterwards showing that information from DNA is transmitted to the ribosome for protein synthesis using mRNA. If DNA serves as the complete library of cellular information, mRNA serves as a photocopy of specific information needed at a particular point in time that serves as the instructions to make a protein.

The mRNA carries the message from the DNA, which controls all of the cellular activities in a cell. If a cell requires a certain protein to be synthesized, the gene for this product is &ldquoturned on&rdquo and the mRNA is synthesized through the process of transcription (see RNA Transcription). The mRNA then interacts with ribosomes and other cellular machinery (Figure (PageIndex<3>)) to direct the synthesis of the protein it encodes during the process of translation (see Protein Synthesis). mRNA is relatively unstable and short-lived in the cell, especially in prokaryotic cells, ensuring that proteins are only made when needed.

Figure (PageIndex<3>): A generalized illustration of how mRNA and tRNA are used in protein synthesis within a cell.

rRNA and tRNA are stable types of RNA. In prokaryotes and eukaryotes, tRNA and rRNA are encoded in the DNA, then copied into long RNA molecules that are cut to release smaller fragments containing the individual mature RNA species. In eukaryotes, synthesis, cutting, and assembly of rRNA into ribosomes takes place in the nucleolus region of the nucleus, but these activities occur in the cytoplasm of prokaryotes. Neither of these types of RNA carries instructions to direct the synthesis of a polypeptide, but they play other important roles in protein synthesis.

Ribosomes are composed of rRNA and protein. As its name suggests, rRNA is a major constituent of ribosomes, composing up to about 60% of the ribosome by mass and providing the location where the mRNA binds. The rRNA ensures the proper alignment of the mRNA, tRNA, and the ribosomes the rRNA of the ribosome also has an enzymatic activity (peptidyl transferase) and catalyzes the formation of the peptide bonds between two aligned amino acids during protein synthesis. Although rRNA had long been thought to serve primarily a structural role, its catalytic role within the ribosome was proven in 2000. 2 Scientists in the laboratories of Thomas Steitz (1940&ndash) and Peter Moore(1939&ndash) at Yale University were able to crystallize the ribosome structure from Haloarcula marismortui, a halophilic archaeon isolated from the Dead Sea. Because of the importance of this work, Steitz shared the 2009 Nobel Prize in Chemistry with other scientists who made significant contributions to the understanding of ribosome structure.

Transfer RNA is the third main type of RNA and one of the smallest, usually only 70&ndash90 nucleotides long. It carries the correct amino acid to the site of protein synthesis in the ribosome. It is the base pairing between the tRNA and mRNA that allows for the correct amino acid to be inserted in the polypeptide chain being synthesized (Figure (PageIndex<4>)). Any mutations in the tRNA or rRNA can result in global problems for the cell because both are necessary for proper protein synthesis (Table (PageIndex<1>)).

Figure (PageIndex<4>): A tRNA molecule is a single-stranded molecule that exhibits significant intracellular base pairing, giving it its characteristic three-dimensional shape.

Table (PageIndex<1>): Structure and Function of RNA
mRNA rRNA tRNA
Structure Short, unstable, single-stranded RNAcorresponding to a gene encoded within DNA Longer, stable RNA molecules composing 60% of ribosome&rsquos mass Short (70-90 nucleotides), stable RNA with extensive intramolecular base pairing contains an amino acid binding site and an mRNA binding site
Function Serves as intermediary between DNA and protein used by ribosome to direct synthesis of protein it encodes Ensures the proper alignment of mRNA, tRNA, and ribosome during protein synthesis catalyzes peptide bond formation between amino acids Carries the correct amino acid to the site of protein synthesis in the ribosome

What are the functions of the three major types of RNA molecules involved in protein synthesis?

RNA as Hereditary Information

Although RNA does not serve as the hereditary information in most cells, RNA does hold this function for many viruses that do not contain DNA. Thus, RNA clearly does have the additional capacity to serve as genetic information. Although RNA is typically single stranded within cells, there is significant diversity in viruses. Rhinoviruses, which cause the common cold influenza viruses and the Ebola virus are single-stranded RNA viruses. Rotaviruses, which cause severe gastroenteritis in children and other immunocompromised individuals, are examples of double-stranded RNA viruses. Because double-stranded RNA is uncommon in eukaryotic cells, its presence serves as an indicator of viral infection. The implications for a virus having an RNA genome instead of a DNA genome are discussed in more detail in Viruses.


Ribonucleic Acid (RNA): An Overview

In broad features, the chemistry of RNA is comparable to the chemistry of DNA.

The chemical analysis shows the following two main differences in the polynucleotide chains of DNA and RNA:

(i) The sugar in RNA is ribose whereas it is deoxyribose in DNA.

(ii) While in DNA, the common bases are adenine, guanine, thymine and cytosine, the RNA contains adenine, guanine, cytosine and uracil (i.e., in RNA molecule, uracil takes the place of thymine). Chemical analysis of RNA molecules obtained from different sources has revealed that base pair ratios (i.e., A/U = C/G) are not equal in those molecules.

RNA is found in the form of a polynucleotide chain which consists of 4 monomeric ribotide or ribonucleotides, namely, AMP, GMP, CMP and uredine monophosphate or UMP.

DNA acts as a template for RNA synthesis. The RNA molecule is assembled from four ribonucleoside 5-triphosphates namely adenosine triphosphate (ATP), guanosine triphosphate (GTP), Cytidine triphosphate (CTP) and uridine triphosphate (UTP) on the surface of one of the two strands of DNA in presence of a specific enzyme called RNA Polymerase. This process is called transcription (Fig. 10.2 A).

The reaction is given below:

The primary reaction during the RNA chain growth is also comparable, since the two terminal phosphates of ribonucleoside triphosphate are split off while a nucleotide unit with one phosphate group is added to the 3′ end of the chain.

Since ribose and deoxyribose differ only in one oxygen atom, while uracil and thymine differ only in a methyl group, inter-conversion of RNA and DNA precursors takes place very readily in living cells (Du Praw, 1970). Single strands of RNA are polarized 3′-5′ polyribotide chains and complementary RNA chains also pair into double helices very readily and hydrogen bonds are established between G—C and A—U base pairs.

The three-dimensional structure of RNA is less defined. RNA is commonly found in single stranded state. It does have regions of double helical configuration where the same chain loops upon itself forming hydrogen bonded base pairing structure which may sometime be folded on itself to form localized helical regions.

The relationship of RNA polymerase to its template DNA is different from that of DNA polymerase reaction in the following two respects:

(i) There is a notable preference for a helical DNA as template and as reported by Hurwitz et al. (1963), the two strands of DNA are not dispersed during the reaction.

(ii) Only one of the two complementary strands of DNA is copied (or transcribed) to determine the sequence of ribotides in the RNA chain (Hayashi et al., 1964).

The rarity of complementary RNA strands follows from the mechanism of RNA synthesis which produces only one chain at a time.

Genome contains complete information for the structure and function of organism, but not all genes are active at any one time. DNA does not act as template for the synthesis of proteins. The genetic information of DNA is transferred to RNA molecules. This process is called transcription. It is actually RNA that acts as a template to produce sequence of aminoacids or protein. This process is called translation.

The common features of transcription in both prokaryotes and eukaryotes are as follows:

1. For transcription two strands of DNA unwind locally and for each gene—only one strand of the double helix DNA acts as template for RNA synthesis. That is called sense strand and the opposite strand of DNA is termed antisense strand.

2. The product of transcription is single stranded RNA.

3. Ribonucleoside triphosphates-ATP, GTP, CTP and UTP are RNA precursors that are polymerised into RNA chain. Polymerization is catalysed by the enzyme RNA polymerase and Mg ++ .

4. RNA polymerisation reaction is similar to the of DNA polymerization. RNA polymerase selects ribonucleoside phosphate to form complementary base pairs with the exposed nucleotides of sense strand of DNA.

5. RNA is synthesized in 5′ – 3′ direction e.g., if DNA template strand is3′-TCCGATTT-5′ the RNA chain would be5′-AGGCUAAA-3′.

The process of transcription on prokaryotic DNA proceeds in the following sequence:

1. Prokaryotic organisms have their own RNA polymerases. Bacteriophages use host’s RNA polymerases or code for their own. Transcription requires double stranded DNA, all four ribonucleoside triphosphates, RNA polymerase enzyme with sigma factor, Mg ++ ions and nus A protein factor. RNA polymerases core enzyme is composed of 4 subunits β’, β, and 2 α subunits (Fig. 10.22).

β’ subunit of core enzyme is DNA binding subunit. It binds to the sense strand of DNA at a specific site called promoter. The other DNA strand which is not transcribed is called anti sense (Fig. 10.23).

Each gene (a specific length of DNA on one strand of helix) is divided into coding and non-coding regions (Fig. 10.24). A coding region carries a nucleotide sequence with hereditary information. Coding sequence is flanked on either sides by non-coding sequences.

Non-coding sequence upstream is organised into promoter region with a set of seven nucleotides in the middle, called Pribnow Box. Between promoter and coding sequences is a short stretch of nucleotides called initiator site which signals transcription of the coding sequence.

The non-coding region downstream has a set of nucleotides called terminator which terminates transcription. Thus Promoter allows binding of the enzymes for transcription, the initiator gives the start signal for transcription of coding region and the terminator acts as a stop signal for transcription.

2. About 35 base pairs upstream from the start of RNA synthesis is a recognition site. RNA polymerase probably first binds there and then slides to the Pribnow box to initiate transcription β’ subunit of core enzyme binds to the sense strand of DNA at promoter sequence.

Before binding to DNA, the core enzyme becomes associated with σ (sigma) factor which plays an important role in transcription, a factor is a 95,000 dalton polypeptide. It initiates RNA synthesis at promoter site along the DNA.

If o factor is not linked to RNA polymerase, the enzyme can initiate RNA synthesis, but at random and then both strands are copied instead of one.

3. RNA polymerase then catalyses denaturation or separation of two DNA strands exposing the template strand for initiation of RNA synthesis (Fig. 10.25).

4. RNA synthesis starts, on DNA template in 5′ to 3′ direction. The ribonucleotides come one after another in an array and form complementary base pairs with the bases of exposed template strand of DNA. The consecutive ribonucleotides are liked by formation of phosphodiester bonds in the same way as in DNA synthesis.

This process is catalysed by P subunit of RNA polymerase. When the polymerisation has started, o factor which acted like a catalyst in initiation of RNA synthesis at specific site dissociates from core enzyme and becomes available for initiating on other transcription site.

5. When the gene has been transcribed, a protein factor called nus-A becomes linked to RNA polymerase and the process of transcription is stopped. Then nus-A, core enzyme or RNA polymerase and RNA strand are separated. The release of RNA strand from DNA template requires the activity of a P (rho) protein.

6. When newly synthesised RNA is displaced, DNA strands renaturate to form double-helical DNA.

Transcription in Eukaryotes:

Although RNA synthesis in eukaryotes takes place more or less in the same way as in prokaryotes, yet some differences are there:

(i) In controlling sequences, and

(ii) Involvement of more than one RNA polymerase enzyme in eukaryotic organisms. In eukaryotes, three RNA polymerases RNA polymerase I, RNA polymerase II and RNA polymerase III are known which play special roles in RNA synthesis. All the three RNA polymerases are complex polypeptides, each consisting of several subunits.

As regards transcription controlling sequences, the base pair sequences upstream from coding sequence indicate the presence of consensus sequence TATAAA called TATA box or the Goldberg- Hogness box about 30 basepairs upstream from the coding sequence. That is considered to be promotor sequence. Further upstream from TATA Box, some other sequences also play role in regulating transcription.

Several types of promoter sequences are used in eukaryotes. The terminator sequences downstream of coding sequence are not properly understood in eukaryotes. In yeast, part of termination sequence is TTTTTATA.

There are different types of RNA which perform different functions. These RNAs are categorized as follows:

A. genetic RNA or Viral RNA

In most of the plant viruses and in some of bacteriophages and animal viruses, the hereditary material is single stranded RNA. In a few cases such as the poliovirus, influenza virus and reovirus, the RNA is double stranded.

The viral RNA is also called genetic RNA because it contains all the information which are normally found in DNA in higher organisms. Molecular weights of RNA in viruses can vary greatly. Larger virus particle has got larger RNA molecule than the smaller ones.

Each Tobacco Mosaic Virus (TMV) with particle weight 4吆 7 contains a single strand of RNA of molecular weight 2.2 X 10 6 . TMV RNA is one of the most intensively studied and one of the best understood molecules of RNA. The double stranded RNA of viruses follows the same basic rules of base pairing as in DNA.

The genetic RNAs found in viruses act as informational molecules. However, the information is not transferred from RNA to RNA. Here the viral RNA acts as template for DNA synthesis by reverse transcriptase (Reverse transcription). The DNA strand synthesized on viral RNA is involved in the synthesis of complementary viral RNA. Viral RNA cannot replicate by itself while present in the host cell.

The viral RNA functions directly as a messenger RNA which in association with ribosomal apparatus of the host cell directs on one hand the synthesis of proteins that form the viral sheath and on the other hand RNA polymerase enzyme which is required in RNA replication.

With the help of RNA polymerase and base pairing rules, the viral RNA synthesizes a complementary RNA chain on its surface and thus double stranded structure is produced.

The hereditary material in cellular forms of organisms is DNA. RNA, though present in good quantity, does not act as genetic material. It plays very important roles in the synthesis of cellular proteins.

The different types of non-genetic RNA found in the cell are as follows:

(i) Ribosomal RNA (rRNA) which is sedimented at high speed in the ultra-centrifuge.

(ii) Transfer RNA (tRNA) (formerly called soluble RNA or s RNA) which remains in the supernatant after the sedimentation of ribosome.

(iii) Messenger RNA (mRNA) which incorporates labelled uracil before other RNAs.

It is the most stable RNA which occurs in ribosomes. About 80% of the total cellular RNA occurs in ribosomes. Ribosomal RNA makes up about 40-60% of the total weight of ribosomes. Each ribosome consists of one large and one small subunit. Both subunits must associate to function in protein synthesis. The association and dissociation of two subunits depend on the Mg ++ concentration.

The ribosomes are usually characterized by their sedimentation coefficients obtained by analytical ultracentrifugation experiments. The ribosomes of eukaryotes sediment at about 80S whereas in bacteria they sediment at 70S. Both these types of ribosomes are structurally similar and are complexes of rRNA and proteins.

The ribosomes of eukaryotic cells contain 28S RNA, 5.8S RNA and 5S RNA in the larger (60S) subunit and 18S rRNA in the smaller (40S) subunit. The ribosomes found in prokaryotes and those found in the plastids and mitochondria of eukaryotes also contain three kinds of rRNA 23S RNA and 5S RNA in larger (5OS) subunit and 16S RNA in smaller (3OS) subunit.

Ribosomal RNA contains the four major RNA bases with slight degree of methylation.

The G/C and A/U ratios in the ribosomal RNAs of different sources vary considerably. The one regularity that has been observed is that rRNA from all sources has a G + C contents more than 50%.

Its molecule appears as single polynucleotide strand which is unbranched and flexible (primary structure) but at low ionic strength, it shows random coiling. At high ionic strength, the molecule shows helical regions with complementary base pairing and looped outer region (Secondary structure) (Fig. 10.26).

Physical studies of rRNA, such as hyperchromicity, melting point and viscosity studies, suggest that a great deal of base pairing occurs within the isolated rRNA molecules, but this is not clear how regularly periodic it is or whether it has any relevance to the structure of the RNA in the ribosomes.

In eukaryotic cells of plants and animals the different types of rRNA molecules are transcribed on rDNA in the nucleolar organizer region of a particular chromosome to which nucleolus is attached.

The important steps in the synthesis and maturation of eukaryotic ribosome are outlined below:

(a) The ribosomal DNA (rDNA) located in the core of the nucleolus synthesizes 45S RNA which is a large initial precursor molecule for 28 S RNA and 18 S RNA.

(b) 45 S RNA is combined with proteins to form a complex of S = 80. The proteins of this complex may include ribosomal and other types.

(c) 45 S RNA is cleaved into 18 S and 32 S pieces. During this period changes in protein composition may take place and side by side loss of some accessory proteins and alterations in the configuration of the two particles may also take place.

(d) 5 S RNA of non-nucleolar origin is incorporated with the 32 S RNA to form a large 65 S subunit which is in due course of time converted into a 60 S or larger subunit of ribosome.

(e) 18 S RNA piece produces 40 S or smaller subunit of ribosome.

(f) The ribosomal subunits along with residual accessory proteins leave the nucleoplasm and come to cytoplasm through annuli of nuclear envelope. In the cytoplasm the two ribosomal subunits (60 S and 40 S) become associated to form a whole ribosome (Fig. 10.27).

As regards the biosynthesis of prokaryotic ribosomes, enough information’s are available about their protein and RNA components.

According to Smith et al. (1968), genes coding for 5 S, 23 S and 16 S rRNAs found in 70S ribosomes of bacteria and according to M Nomura and Associates (1969) 16 S, 23 S and 5 S RNA sequences found in 50 S ribosomes of Escherichia coli are tightly clustered in the region of bacterial DNA and are present in several copies.

The primary transcript of each repeat unit in a precursor-z-RNA (Pre rRNA) of 30 S (p 30 S) which is cleaved to produce p 16 S, p 23 S, and p5 S RNAs, which are immediate precursors of mature 16 S, 23 S and 5S rRNAs respectively. Normally 30 S Pre rRNA molecule is not observed in wild type cells because the cleavaging occurs while p 30 S is still in the process of transcription. (Fig. 10.28).

The pre-rRNAs undergo both tailoring and chemical modification before they become mature rRNAs. During tailoring of larger rRNA molecule, 16 S rRNA sequence is first cleared off and separated from 23 S and 5 S sequences. The fragment containing 16 S information is still larger than the mature 16S rRNA by at least 100 bases and is not methylated.

Methylation and tailoring of this molecule occur after it has associated with a number of proteins to form the precursor ribosomal subunits. 5 S rRNA does not undergo tailoring and methylation before it becomes mature. The whole process of biogenesis of 70 S ribosome occurs in cytoplasm.

The methylation thus occurs after transcription and most of the methyl groups are added to the bases, with only a few added to the 2-OH of ribose moity. .All the methylations of 23 S rRNA occur on the p 30 S RNA component whereas most, if not all, of the methyl groups of 16 S rRNA are added when it is in a mature form.

Thus methylation of 23 S rRNA is an early event and methylation of 16 S rRNA is a late event in the rRNAs processing.

The functions of rRNA are still not properly understood. The main function of rRNA is evidently to serve as the site for finding of single stranded mRNA.

Transfer RNA:

When a cell homogenate containing 10 M of Mg is centrifuged at high speed (100,000 Xg for 120 minutes) the RNAs of high molecular weights bound to ribosomes are sedimented and the supernatant liquid so obtained contains a fraction of RNA which is called transfer RNA or tRNA. Earlier, it was called soluble RNA (sRNA).

RNAs available in the supernatant liquid have a “transfer function” and act as “adaptors” (or connectors) between the amino acids and messenger RNA. Transfer RNAs make up about 15% of the total cellular RNA. Transfer RNAs are the small natural nucleic acids with sedimentation coefficient of 4.

The nucleotide chain length is remarkably uniform for all the tRNAs of prokaryotes and eukaryotes, ranging from 76 to 85 nucleotides. The cells probably contain more than 60 different types of tRNA molecules, molecular weight ranging from 25,000 to 30,000 daltons (one dalton = Atomic weight of hydrogen).

Each molecule has a specificity for a given amino acid to which it can attach by a covalent bond. Holley et al. (1965) showed that tRNA which is specific for alanine in yeast cells consists of 77 nucleotides (mol. wt = 26,600) including 8 A, 12U, 25G, 23C and 9 unsaturated bases (mostly methylated bases).

Medison et al. (1967) have shown that tyrosine tRNA consists of 78 nucleotides and Zachan et al. (1967) have shown that serine tRNA is composed of 85 nucleotides.

The A/U and G/C ratios approach equality, so that there is a possibility for considerable base pairing within the molecule. tRNA is actually a single polynucleotide chain which is apparently bent in the middle and the two arms form loops. Thus the molecule becomes clever leaf like. All tRNA molecules have the sequence CCA at the 3′ end and G residue at 5 end.

It is at the 3′ end of the chain (CCA-OH end) that the activated amino acid is attached during the protein synthesis. tRNA molecule appears as a single strand of polynucleotides (primary structure). Holley et al. (1965) first proposed the clover leaf pattern of tRNA molecule (Secondary structure) (Fig. 10.29).

Lake and Beeman (1967) have shown that tRNA molecule consists of 3 folds giving it a shape of the clover leaf According to clover leaf model the single polynucleotide chain of tRNA is folded upon itself to form 5 arms. As a result of folding 5′ and 3′ ends of the polynucleotide chain come near each other.

Some of the arms may be differentiated into stem and a loop. In the stem region juxtaposed bases are complementary and paired but in loop there is no pairing.

As regards the structure and function of tRNA molecule the following general conclusions have been made (Fig. 10.30):

(i) The sequence of bases is such that in each case the molecule can form a hydrogen bonded “clover leaf configuration in which CCA bases at 3′ end stick out. The last residue, adenylic acid (A), is the amino acid attachment site. At the 3′ terminal, the sequence CCA — OH is added to all tRNAs post transcriptionally.

(ii) All tRNAs have one part (right loop of the chain) which is common and which consists of seven unpaired bases including pseudouridine (Ѱ). It is known as the TѰC arm. It may be involved in the binding of the tRNA to the ribosome.

(iii) All the tRNA molecules contain 7-15 unusual bases, many of which are methylated or demethylated derivatives of A,U, G and C. Unusual bases are nucleotides of methylinosine (Mel), pseudouridines (Ѱ U or UH2), methylated purines (methylated A and G), methylated pyrimidines such as methylated thyamine or ribothymine, 5 methyl cytosine and others. Not all these unusual bases are present in one tRNA.

(iv) There is one nucleotide triplet in the bottom loop of the chain which is different in all tRNAs examined so far. That is called anticodon. The anticodon is site which probably is commentary to the codon on the messenger RNA and is the site of base pairing between tRNA and mRNA. The nucleotide to the 5′ side of anticodon is always U and that to the 3′ side is always a modified purine.

(v) In the left loop of all tRNA there occurs DHU (Dihydrouridine) base. The DHU arm has a site for the recognition of the amino acid activating enzymes.

(vi) One of the most important structural similarities among the clover patterns of various tRNA molecules is that the overall distance from CCA at one end to the anticodon at the other end appears to be constant (Fig. 10.31).

The difference in nucleotide numbers in different molecules being compensated for by the size of the little loop or “extra arm” located between the right loop and the bottom limb (Figs. 10.29 and 10.30). Unusual bases, such as, dimethyl guanosine, dime A, MeG are located in regions not forming hydrogen bonds. Dimethyl guanosine usually occurs in the comer between the left and bottom loops.

This suggests that the role of usual bases is to help to determine the three-dimensional structure of tRNA which is of crucial importance. Tertiary structure of tRNAs. The application of x-ray crystallography to the stable crystals of tRNA has revealed the tertiary structure of tRNA including the location of the major groups.

The data revealed that all the double helical stems predicted by the clover leaf model do exist and, in addition, some hydrogen bonds bend the clover leaf model into a stable, rough L-shaped appearance, in which the amino acid binding CCA-OH group at 3′ end of the chain is located at the opposite end from the anticodon loop.

Biosynthesis of tRNA:

Unlike mRNAs the tRNA molecules are modified extensively. In-deed, mature tRNAs not only have modified bases but are considerably shorter than the primary gene transcript. In both prokaryotes and eukaryotes primary gene transcripts called Precursor-tRNAs (Pre-tRNAs) are produced which are later clipped and trimmed to produce mature tRNA molecule.

In prokaryotes pre-tRNAs contain either single tRNA molecule with extra leader and trailor sequences at the 5′ and 3′ ends or contain several species of tRNA molecules each. In the latter case the tRNA molecules are separated by spacer nucleotide sequences.

At least two enzymes take part in the processing of pre-tRNAs:

(i) Ribonuclease P catalysing the removal of leader sequence at 5′ end and

(ii) Ribonuclease Q catalysing the removal of 3′ trailor sequence. Another enzyme is also involved in the removal of spacer sequences from multi tRNA precursor to liberate tRNA molecules.

In eukaryotes the pre-tRNAs are larger by some 15-35 nucleotides than die mature tRNAs. The processing of pre-tRNAs presumably occurs, although, the enzymes involved and the sites of their action are not yet known.

The transfer RNAs show specificity in attaching to amino acids (Fig. 10.32). So, there must be at least 20 different tRNAs in the cytoplasm of a cell.

The function of tRNA is to carry a particular amino acid at a definite place on the mRNA.

Four recognition sites in tRNA to achieve this purpose are as follows (Fig. 10.32):

(i) The amino acid attachment site which is CCA sequence at the 3′ terminal.

(ii) Antlcodon which is a group of middle three bases on the bottom loop of tRNA molecule. Anticodon of tRNA recognises three complementary bases of a codon in mRNA molecule.

(iii) Ribosome recognition site which is common to all tRNA molecules and is found in TѰC loop. This consists of GTѰCG sequence.

(iv) Amino acid activating enzyme recognition site or syntheses site found in left arm which activates the enzyme and charges specific amino acid with tRNA.

Messenger RNA:

Messenger RNA. Jacques Monod and Francois Jacob (1961) of Pasteur Institute in Paris coined the term “messenger RNA” to describe the template RNA that carried genetic information for protein synthesis from nuclear DNA to ribosomes in the cytoplasm, Messenger RNA makes up less than 5% of the total cellular RNA.

Messenger RNA is normally attached to the smaller subunits of Ribosomes and the length of mRNA is such that it connects a number of ribosomes and, indeed, such clusters of ribosomes called polyribosomes or polysomes have been observed with electron microscopes. mRNA is assembled on a DNA template.

Since DNAs of different organisms differ only in the sequence of their bases, mRNAs which are formed from them must reflect different base sequences. The mRNA is complementary copy of DNA. This was demonstrated experimentally in 1960 by Marmur and Lane.

They showed that if DNA molecules are heated to 100°C, the two polynucleotide chains separate because the H bonds holding the base pairs of the opposite strands are disturbed. This process is known as ‘DNA denaturation’.

If the temperature is lowered, the complementary strands again unite. This is renaturation of DNA. These investigations also showed that isolated DNA strands could make hybrid or the mRNA. Several recent experiments indicate that only one strand of double stranded DNA molecule acts as template in mRNA synthesis.

Thus we can presume that mRNA is single stranded. mRNA shows base sequence that is complementary to that of template DNA. This process is called “transcription”.

This is just like replication. The only difference between the two processes is that in transcription thymine (T) is substituted by uracil (U) in mRNA, i.e., opposite adenine (A) of DNA comes U in mRNA. The mechanism of transcription is shown in Fig. 10.25. The enzyme RN A- polymerase has been found to catalyse synthesis of RNAs from ribonucleoside triphosphates (ATP, GTP, UTP, and CTP) on DNA template.

In eukaryotes, the mRNA migrates out of nucleus to the cytoplasm where the ribosomes are active in protein synthesis.

The main differences between prokaryotic mRNA and eukaryotic mRNA are as follows:

(i) mRNAs of prokaryotes are transcribed from several adjacent genes and as such the mRNAs are called polygenic or polycistronic mRNAs. In eukaryotes, however the mRNAs are transcribed on single genes hence they are called monogenic or monocistromic mRNA.

(ii) mRNAs in prokaryotes have short life times and are not processed whereas those of eukaryotes are processed and exhibit a range of life-times.

(iii) mRNAs of prokaryotes are transcribed on most of the genome where as those of eukaryotes are transcribed only on small fractions of genome.

At any one time less than 20% of the total cellular RNA is mRNA in either prokaryotic or eukaryotic cell.

Examination of mRNAs reveals that mRNA molecules are of variable length with fairly wide range of sedimentation coefficient (S values). That This results from the fact that the number of nucleotide pairs in a gene is related to the size of protein for which they code.

The general structure of nature mRNA molecule is shown in Fig. 10.33. All messenger RNAs are transcribed from the structural genes, i.e., genes that code for proteins.

Each mRNA has the following three main parts (Fig. 10.33):

(i) Leader sequence at 5′ end, the length of which may vary in different mRNAs and within this sequence is present the information for the ribosome to initiate protein synthesis at the correct position. The leader sequence is not involved in the translation process (protein synthesis).

(ii) Protein coding sequence following the leader sequence which is translated into the amino acid sequence of polypeptide, and

(iii) Trailer sequence at 3’end which is not translated and is variable in length in different mRNAs. The polycistronic mRNAs found in prokaryotes have leader and trailer sequence on the sides of the coding sequences.

The DNA of eukaryotic chromosome is organized into nucleosome structures. Many studies have shown that active chromatin is more sensitive to deoxyribonuclease attack than the non- transcribing chromatin. This indicates that transcribed segments of chromatin must have a different structural conformation than the inactive chromatin.

This is, however, not due to any major change in the nucleosome structure. Unlike, prokaryotic mRNAs, mRNAs, of eukaryotes are modified at both 5′ and 3′ ends. The modifications occur after transcription under the influence of specific enzymes.

Messenger RNA has the following structural features:

At the 5′ end of the mRNA strand there occurs a cap which is blocked by methylated structure (any of the four nucleotides with 2-OH methyl ribose). Messenger RNA without cap shows poor binding of ribosomes and so the cap of mRNA influences the rate of protein synthesis (Fig. 10.34).

2. Non-coding region 1 (NCI):

Next to cap is non-coding region of 10-100 nucleotides which is rich in A and U bases and does not translate into protein.

3. The Initiation Codon:

This is AUG codon which initiates the polypeptide chain.

Next to initiation codon comes the coding region which consists of about 1500 nucleotides on the average. This translates a particular protein molecule.

Next to the coding region there is termination codon which terminates protein synthesis on mRNA. In mRNA of eukaryotes, codons UAA, UAG and UGA act as termination codons.

6. Non-coding region (NC2):

This region lies next to termination codon which consists of 50-150 nucleotides. This region does not translate into protein. This region contains AAU sequence in all the cases.

At the 3′ end there is a polyadenylate or poly-A (as AAAAA-) sequence which initially consists of200-250 nucleotides. Poly-A sequence is added in the nucleus before mRNA is transferred to cytoplasm. Poly-A sequence becomes reduced in extent with the age.

Split Genes and mRNA Production in Eukaryotes:

In eukaryotic nucleus a rapidly labelled RNA, called heterogenous nuclear RNA (hn RNA) species can be isolated which is different from rRNA and tRNA or their precursors. The hn RNA is heterodispersed in length and is much longer than the cytoplasmic wRNA and has both 5’and 3′ poly- A modifications characteristic of cytoplasmic mRNAs.

The hn RNA acts as pre- mRNA or precursor to the functional mRNAs, the former being processed to form latter in the nucleus.

A large fraction (approximately 90% of the hn RNA) is degraded and thus only a small portion of this is transported in the form of mRNA. In 1977, A.J. Jeffreys and R.A. Flavell discovered that some 600 base pairs (bp) sequence was inserted within the coding sequence for 146 aminoacids β globin chain in rabbit. The insert has been named an intervening sequence or intron and the coding sequences the exons.

The introns are transcribed and are not translated. An intron is a sequence in gene that separates coding sequences of genes. A large number of coding genes contain introns in eukaryotes. In higher eukaryotes, they are more extensive than in lower eukaryotes. Not all eukaryotic protein coding genes have introns. Histone genes of invertebrates are uninterrupted.

In general, there is no definite pattern to show as to which type of genes are interrupted and which type of genes are not. Simple model for the production of functional mRNA is presented in the Fig. 10.35. At first, both coding sequences and introns are transcribed but each intron is subsequently removed in such a way that the adjacent coding genes are spliced together to form a continuous sequence.

The process is summarized as under:

(i) RNA polymerase binds to the promoter and transcribes on the DNA continuously until a termination is reached, i.e., leader trailer and coding sequences as well as introns are transcribed.

(ii) Transcript becomes capped at the 5′ end. The transcript is then cleaved near the 3′ end and a poly-A tail is added to the new 3′ end to produce a precursor mRNA (pre-mRNA) which is longer than the mature mRNA because of presence of introns. The pre-mRNA molecule constitutes hn RNA

(iii) The pre-mRNA molecule is processed to remove introns which are looped out and sub squinty the loops are removed by nucleases. The new adjacent coding sequences are then linked or spliced together. This is called splicing of introns. It is known that all introns start with GU and end with AG and these sequences are presumably crucial for the correct splicing.

Many investigators like Spirin, Beltisina and Lerman (1965), Perry and Kelley (1968) and Henshaw (1968) have reported that in certain eukaryotic cells the messenger RNA does not enter the cytoplasm as a naked RNA strand but often remains ensheathed by certain proteins.

Spirin has proposed a term informosome for mRNA-protein complex. The proteins of informosome provide stability to the mRNA and protect mRNA from degrading action of ribonuclease enzyme.


Access options

Get full journal access for 1 year

All prices are NET prices.
VAT will be added later in the checkout.
Tax calculation will be finalised during checkout.

Get time limited or full article access on ReadCube.

All prices are NET prices.


2 CORONAVIRUS CAPPING AND POLYADENYLATION

Coronaviruses possess a conventional 7meGppp cap at the 5′ end of their positive-sense genomic and mRNAs and also contain 2′O-methylations at their 5′ terminal nucleotides (Chen & Guo, 2016 ). These 5′ terminal 2′O-methylations are important for viral evasion of cellular innate antiviral effectors as the host IFIT1 (interferon-induced protein with tetratricopeptide repeats 1) protein will recognize versions of viral caps that lack these modifications and activate a robust interferon response (Abbas et al., 2017 Daffis et al., 2010 ). A complex of viral nonstructural (nsp) proteins, including, nsp13 (RNA triphosphatase), nsp14 (N7-methyltransferase), and nsp16 (2′O-methyltransferase), is responsible for capping of the 5′ end of coronavirus transcripts (Chen & Guo, 2016 ). Curiously, the viral capping enzyme or guanylyltransferase has not been identified to date. Thus, although there a few short KxDG amino acid motifs in the nsp1ab polyprotein that have been noted to represent a conserved motif of viral capping enzymes (Li, Rahmeh, Morelli, & Whelan, 2008 ), one cannot formally rule out the possibility that a cellular factor provides guanylyltransferase activity. If this were the case, we speculate due to the cytoplasmic nature of the event that perhaps this might be a cellular enzyme associated with cytoplasmic recapping of cellular mRNAs (Trotman & Schoenberg, 2019 ). Finally, all of the genomic and subgenomic mRNAs of SARS-CoV start with a transcribed A residue instead of a G residue that is found at the 5′ terminus in the majority of cellular mRNAs. Interestingly, essentially all cellular mRNAs that start with a transcribed A residue get modified with an m6A modification by the CAPAM protein (Cowling, 2019 ). It will be interesting to investigate whether or not coronavirus genomic RNA and mRNAs have a similar m7G(5′)ppp(5′)m6Am 5′ end structure or not, and implications thereof to virus–host interactions.

While it is clear that the terminal cap and poly(A) tails play vital roles in the life cycle of coronaviruses, we currently have relatively little insight into the enzymes and detailed mechanisms of how they are generated. Additional studies in this area, therefore, would be fruitful in advancing our molecular understanding of viral terminal RNA modifications. Since (based on studies with other cytoplasmic RNA viruses) these terminal RNA modifications are likely one of the few aspects of coronavirus RNA biology that do not usurp host cell enzymes, it may be an area for the development of broad-spectrum anti-coronavirus drugs. For example, a better understanding of the coronavirus nsp interactome and the molecular description of enzymatic functions in capping may provide insight into a novel avenue of coronaviral therapeutic targets as has been proposed for other virus families (Issur, Picard-Jean, & Bisaillon, 2011 ). The viral nsp14 MTase activity, for example, is known to have a unique structure that significantly differs from canonical MTases (Ferron et al., 2018 ), making it an attractive target for small molecule inhibitors. Finally, one of the speculated targets of the FDA-approved antiviral drug ribavirin is the viral RNA capping reaction (Ogino & Ogino, 2017 ). This adds some support for the validity of this aspect of viral RNA biology for drug targeting.


Damaged mRNA and the ribosome

A priori, chemical modification to the mRNA could have three distinct effects on its function during translation ( Fig. 2 ). 1) Modifications that do not alter base pairing between the codon and anticodon interaction are expected to have no effect on protein synthesis. 2) Modifications that change the base-pairing preference of nucleotides are expected to result in miscoding and production of proteins with errors. 3) Modifications that disrupt base pairing altogether are expected to stall the ribosome and lead to the production of abortive protein products. Obviously the latter two are detrimental to proteostasis and potentially necessitate the evolution of pathways to cope with them. This is especially true for the last one, which, in addition to producing truncated protein products, sequesters valuable ribosomes and prevents them from carrying out their function ( Fig. 2 ).

Chemical damage to RNA could affect multiple steps of translation. At the center is a schematic highlighting a eukaryotic mRNA being translated. Damage might alter the structure of the rRNA, the tRNA, and the mRNA. On the rRNA, modifications could affect important functional sites of the ribosome. Shown are the PTC, the GTPase activation center (GAC), and the decoding center (DC). On the tRNA, modifications to the anticodon and acceptor stem, for example, could affect decoding and aminoacylation, respectively. On the mRNA, modifications to the coding sequence could affect the speed and accuracy of translation during elongation.

Although one could learn a lot about how modifications to the nucleobase affect translation from equivalent studies conducted on DNA polymerases, the fact that the ribosome reads three nucleotides at a time makes the decoding process somewhat different from replication. Furthermore, the RNA-rich decoding center and the mechanism by which it recognizes the codon𠄺nticodon minihelix is quite different from the active site of polymerases, which is made entirely of amino acids (78). These distinctions between the ribosome and DNA polymerases are best exemplified by studies characterizing the effect of 8-oxoG on translation. During DNA replication, the oxidative adduct 8-oxoG is highly mutagenic, when it adopts a syn conformation and bp with A (37). During translation, the modification stalls translation and causes little to no miscoding (14). Indeed, initial studies by Shan et al. (79) found that the yield of protein synthesis from RNAs containing 8-oxoG is significantly lower than from those that do not harbor the modification. RNAs treated with hydrogen peroxide and transfected into cell culture produce significantly less functional proteins at a transcript level–independent manner (75). These observations suggest that oxidation of mRNA disrupts protein synthesis and likely stalls elongation by the ribosome. Consistent with these ideas, studies by Tanaka et al. (81) showed that oxidized mRNAs associate with polysomes but produce much less protein products. Because RNA oxidation results in a myriad of modifications, it is difficult to assess which one of these modifications is responsible for stalling the ribosome. Later studies by our group showed that 8-oxoG reduces the rate of peptide-bond formation by up to 4 orders of magnitude using a well-defined in vitro system (14). Interestingly, this effect on decoding is independent of the position of the adduct in the codon. In particular, the third position, which allows for unusual base pairing between the codon and the anticodon, is equally sensitive to the presence of the modification. Based on these observations from multiple groups, it is now generally accepted that 8-oxoG𠅌ontrary to its effect during DNA replication𠅍oes not cause miscoding, but instead it is highly disruptive to translation and leads to the generation of truncated protein products.

In contrast to RNA oxidation, which has been investigated by a number of groups, only a couple of studies have explored the effect of alkylation damage to mRNA on translation. In one study from our group, we examined the effect of O6-mG on decoding using a bacterial reconstituted system (82). This adduct is notable as it is highly mutagenic during DNA replication, whereby the O6-mG:T bp is almost indistinguishable from a normal Watson-Crick bp such that mismatch repair is unable to recognize it (57). Instead, organisms dedicate specialized “suicide” methyltransferases to recognize and repair it (83). Similarly, on the ribosome, O6-mG causes miscoding by mispairing with U but only at the first position of the codon. At the second position, the adduct was found to reduce peptide-bond formation by almost 3 orders of magnitude (82). Again, these observations highlight not only the differences between the ribosome and DNA polymerases but also the position-dependent effects of these modifications on decoding.

N-Alkyl adducts, in contrast to O-alkyl ones, tend to be more cytotoxic and less genotoxic on DNA as they lead to stalled polymerases (84). Whether these modifications stall the ribosome during translation was unknown until recently. In particular, You et al. (85) examined the effect of three N-alkyl modifications on translation efficiency and fidelity using bacterial and eukaryotic extracts. As expected, based on its deleterious effect on base pairing, m1A was found to severely reduce protein-synthesis yield regardless of its position within the codon (85). The severity of the effect, especially at the third position, highlights the deleterious effect of the substitution on the codon𠄺nticodon interaction. Surprisingly, the modification appears to have no effect on the fidelity of translation. Interestingly, m1G inhibits protein synthesis only when placed at the first and second position of the codon (85). At the third position, the modification has no apparent effect on protein-synthesis yield, which is consistent with the promiscuity of tRNA selection at this position. Why m1A and m1G affect decoding disparately at the third position, even though the methyl group is added to same N1 of the purine, can be explained by the introduction of a positive charge in the case of m1A and not m1G. These observations suggest that, in addition to the effect on hydrogen-bonding interactions, other parameters, like charge differences, need to be taken into account when assessing how modifications might affect tRNA selection. Finally, N-alkyl modifications that do not interfere with Watson-Crick base-pairing interactions have a modest effect on protein-synthesis yield and fidelity (85). These include “unintentional” modifications, which are not known to occur naturally in mRNAs such as m2G, and “intentional” ones, which occur naturally in mRNAs such as m6A (83, 86).


Role of PARP-1 and ADPRylation in the regulation of rDNA transcription and ribosome biogenesis

Ribosome biogenesis is a highly coordinated cellular process that involves the synthesis, processing, and modification of rRNAs, as well as the proper assembly of the rRNA with ribosomal proteins (Baßler and Hurt 2019). Emerging evidence highlights the role of ribosome biogenesis in various human cancers and its dysregulation promotes cellular growth and tumorigenesis (Ruggero and Pandolfi 2003 Aspesi and Ellis 2019). Enrichment of PARP-1 in the nucleolus, the site of ribosome biogenesis, was documented from the late 1980s to the early 2000s (Fakan et al. 1988 Desnoyers et al. 1996 Scherl et al. 2002). Subsequent studies have revealed an important role for PARP-1 in regulating multiple steps of ribosome biogenesis. A growing body of evidence supports the important role of PARP-1 in RNA polymerase I (Pol I)-dependent transcriptional regulation, preribosomal rRNA (pre-rRNA) processing, and rRNA modification (Boamah et al. 2012 Guetg et al. 2012). In addition, several studies have determined the physiological functions of PARP-1 in the regulation of ribosome biogenesis in response to DNA damage (Calkins et al. 2013 Bütepage et al. 2018). In this section, we describe in detail the growing awareness of the essential role of PARP-1 in the transcriptional regulation of rDNA and ribosome biogenesis under normal conditions and in various human diseases.

Brief overview of ribosome biogenesis

Ribosome biogenesis, which begins in the nucleolus, is the process by which cells generate new ribosomes to synthesize cellular proteins (Baßler and Hurt 2019). Ribosome biogenesis is a tightly controlled, energy-demanding process, comprising multiple steps including (1) synthesis of four different ribosomal RNA (rRNA) molecules (25S/28S, 18S, 5.8S, and 5S) and 79 ribosomal proteins by all three nuclear RNA polymerases (Pol I, II, and III) in eukaryotes, (2) rRNA processing and site-specific modifications including methylation and pseudouridylation by a small nucleolar ribonucleoprotein (snoRNP), and (3) assembly with rRNAs and ribosomal proteins to form preribosomal particles. After synthesis and assembly steps in the nucleolus and nucleus, the pre-40S and pre-60S ribosomal subunits exit to the cytoplasm to form mature ribosomal subunits (Fig. 3). The functional links among PARP-1, ADPRylation, and ribosome biogenesis are explored in more detail below.

The steps in ribosome biogenesis. rRNA molecules (28S, 18S, 5.8S, and 5S), small and large subunit ribosomal proteins, and assembly or processing factors are synthesized by RNA polymerases (Pol I–III), and are subsequently modified and processed. rRNAs assemble with ribosomal proteins to form preribosome particles, which are exported to the cytoplasm to form mature ribosomal subunits and active ribosomes.

Role of PARP-1 in the formation of silent rDNA chromatin and transcriptional silencing

A newly discovered aspect of PARP-1 function is its role in modulating ribosome biogenesis in normal physiological conditions through PARP-1-mediated ADPRylation (Guetg et al. 2012). Tandemly repeated ribosomal RNA genes (rDNA) exist in two distinct epigenetic states: a permissive state allowing transcription and repressed state inhibiting transcription (Li et al. 2005). NoRC, a nucleolar chromatin remodeling complex comprising SNF2h and TIP5, plays an important role in establishing the silent state of rRNA genes by recruiting a DNA methyltransferase and a histone deacetylase to the rDNA promoter (Santoro et al. 2002). Interestingly, PARP-1 has been implicated in NoRC-mediated establishment of transcriptionally inactive rDNA chromatin during cell division (Guetg et al. 2012). PARP-1 interacts with NoRC-associated RNA (pRNA). This interaction is required for recruitment of TIP5, the large subunit of NoRC, to the promoter of silent rDNA after the passage of the replication fork. NoRC recruits and interacts with the histone deacetylase HDAC1 and DNA methyltransferase (DNMT), leading to epigenetic reprogramming, including histone modification and DNA methylation (Fig. 4A).

Dual roles of PARP-1 in the regulation of rDNA transcription. (A) pRNA-mediates PARP-1 and NoRC complex (TIP5 and SNF2h) interactions, leading to PARP-1 automodification and subsequent TIP5 or histone ADPRylation. TIP5 recruits the histone deacetylase HDAC1, DNA methyltransferase DNMT1, and histone lysine methyltransferase SETBD1 to the establish a silent state on rRNA genes. (B) snoRNAs interact with PARP-1 to activate PARP-1 catalytic activity. Subsequently, snoRNA-activated PARP-1 PARylates DDX21 to promote DDX21 association with the rDNA locus and retention in the nucleolus, promoting enhanced rDNA transcription in cancer.

This epigenetic reprogramming leads to impaired binding of various transcription factors to the rDNA promoter, with subsequent transcriptional silencing and heterochromatin formation. TIP5 is a key regulatory protein in the regulation of silent rDNA chromatin and heterochromatin formation. Importantly, pRNA-mediated TIP5-PARP-1 interactions lead to PARP-1 automodification and subsequent TIP5 and/or histone ADPRylation. Jointly, the studies described here indicate that PARP-1-mediated TIP5 and histone ADPRylation are essential for the formation of silent rDNA chromatin and transcriptional silencing by direct interaction with pRNA and the chromatin-remodeling complex NoRC.

Role of PARP-1 in Pol I-dependent transcription of rDNA

The first evidence of a functional link between rRNA processing and PARP-1 was proposed by Boamah et al. (2012) using Drosophila as a model system. PARP-1 plays an important role in the maintenance of nucleolar structure and function via the regulation of precursor rRNA processing, posttranscriptional modification, and preribosome assembly (Boamah et al. 2012). PARP-1 and its catalytic activity are required for (1) the maintenance of nucleolar integrity and (2) proper localization of nucleolar-specific proteins, such as fibrillarin, AJ1, nucleolin, and nucleophosmin in proximity to precursor rRNA in the nucleoli of Drosophila. Inhibition of PARP-1 enzymatic activity leads to nucleolar fragmentation and aberrant localization of nucleolar-specific proteins. PARP-1 deletion mutants exhibit a delay in rRNA processing and an increase in the levels of rRNA intermediates, such as 47S and 36S rRNA transcripts, which represses ribosome biogenesis (Boamah et al. 2012). The role of PARP-1 in regulating ribosome biogenesis will be discussed below.

Recent advances in chemical biology and protein engineering in the field have led to mass spectrometry-based identification of ADPRylation sites for PARP-1 protein substrates. This has led to the identification of a set of nucleolar proteins, which are key regulators in ribosome biogenesis, including DDX21, fibrillarin, nucleolar phosphoproteins numatrin/B23, and nucleolin/C23, as direct targets of PARP-1 enzymatic activity (Gagné et al. 2012 Chiou et al. 2013 Carter-O'Connell et al. 2014 Gibson et al. 2016 Kim et al. 2019). These PARP-1-ADPRylated proteins are known to be involved in rRNA transcription, pre-rRNA processing, and preribosome assembly, suggesting that PARP-1 and its enzymatic activity are required in nucleolar functions and, consequently, ribosome biogenesis.

In addition to the regulation of rRNA processing, PARP-1 can localize to the nucleolus, and PARP-1 accumulation in nucleoli is altered upon RNA polymerase I inhibition (Meder et al. 2005). Although this study suggests that PARP-1 (and PARP-2) does not affect the transcription of rDNA in murine fibroblasts, other studies have shown a role for PARP-1 in the regulation of rDNA transcription (Kurl and Jacob 1985 Guetg et al. 2012). Another study also reported that the nucleolar localization of PARP-1 is dependent upon active RNA synthesis (Desnoyers et al. 1996). Therefore, it is likely that PARP-1 nucleolar localization and its enzymatic activity are associated with the Pol I-dependent transcription of rDNA in nucleoli. These studies indicate that PARP-1 plays an important role in ribosome biogenesis, including rDNA transcription, processing, and ribosome assembly in the nucleolus. Emerging evidence has also implicated PARP-1 in the regulation of ribosome biogenesis in various human diseases, as discussed below.

Role of PARP-1 in the regulation of ribosomal biogenesis in pathological conditions

PARP inhibitors (PARPi), such as olaparib, rucaparib, niraparib, and talazoparib, are clinically important and have been approved by the FDA as monotherapies for treatment of recurrent, high-grade serous ovarian cancers with BRCA1/2 mutations (Bitler et al. 2017 McCann 2019). Olaparib has also been approved for the treatment of BRCA-mutated HER2-negative metastatic breast cancers (Robson et al. 2017), while niraparib has been shown to be efficacious in patients lacking BRCA mutations or HR deficiency (Mirza et al. 2016). These PARPi are currently being evaluated for their therapeutic potential in several other cancers. PARPi, acting through nuclear PARPs, are thought to control cancer cell growth primarily through inducing synthetic lethality in cancers that are deficient in homologous recombination (HR)-mediated DNA repair (e.g., in BRCA1/2 mutant cells) (Bryant et al. 2005). In the absence of functional BRCA1 or BRCA2 proteins, PARPi lead to the persistence of DNA lesions, resulting in chromosomal instability, subsequent cell cycle arrest, and apoptosis (Bryant et al. 2005 Farmer et al. 2005).

Growing evidence has shown that PARPi have therapeutic efficacy in BRCA1/2 wild-type cancers lacking other known HR or DNA repair defects. Interestingly, a recent study from our laboratory highlights the pathological significance of PARP-1-mediated site-specific ADPRylation events that are independent of PARP-1's role in DNA repair (Kim et al. 2019). Mechanistically, this study found that snoRNAs act as critical players in the activation of PARP-1 enzymatic activity in the nucleolus, which leads to DDX21 ADPRylation. DDX21 ADPRylation results in enhanced rDNA transcription, as well as breast cancer cell growth (Fig. 4B). Treatment with PARPi or mutation of the ADPRylation sites in DDX21 reduces DDX21 nucleolar localization, rDNA transcription, ribosome biogenesis, and cell growth (Kim et al. 2019). Thus, this study has uncovered an alternate molecular pathway for targeting breast cancer with PARPi irrespective of BRCA1/2 status by attenuating cancer-enhanced ribosome biogenesis. As such, this study strengthens the rationale for advancing the use of PARPi in clinical trials for the treatment of a broader array of cancers, including those with wild-type BRCA1/2.

Results from Guetg et al. (2012) using HEK-293T cells suggest an alternate mechanism for PARP-1's role in rDNA transcription, where PARP-1 and its enzymatic activity promote the formation of silent rDNA chromatin and transcriptional silencing of the rDNA locus. Increased numbers of ribosomes are required for the uncontrolled cellular proliferation and division of cancer cells compared with normal cells (Aspesi and Ellis 2019). PARP-1 and its enzymatic activity are significantly up-regulated in invasive cancer cells, as well as malignant tissues (Ossovskaya et al. 2010 Domagala et al. 2011). Thus, it is possible that the dual role of PARP-1 is based on the different amount of ribosomes present in cancer and normal cells to meet their need for protein synthesis and proliferation.

Interestingly, a recent study reported dispersed and less intense nucleolar PARP-1 staining in Alzheimer's disease (AD) compared with the distinct nucleolar localization in hippocampal pyramidal neurons in controls (Zeng et al. 2016). This study proposes that PARP-1 mislocalization from the nucleolus in AD (1) leads to hypermethylation of rDNA by DNA methyltransferase 1 (DNMT1), (2) subsequently reduces rDNA transcription and impairs ribosomal biogenesis, and (3) results in disruption of long-term memory formation (Fig. 5A,B). PARP-1-mediated DNMT1 ADPRylation inhibits the activity of DNMT1, subsequently preventing rDNA methylation and up-regulating rRNA expression. While these observations need to be confirmed, they suggest an interesting link between PARP-1 mislocalization and brain pathologies.

Role for PARP-1 in the regulation of rDNA transcription in neurons. (A) PARP-1-mediated DNMT1 ADPRylation prevents rDNA methylation by DNMT1, resulting in the production of rRNAs and subsequent ribosome biogenesis in normal neurons. (B) A substantial reduction in the nucleolar localization of PARP-1 leads to hypermethylation of rDNA by DNMT1, resulting in a reduction of rDNA transcription and ribosome biogenesis. Impaired ribosome biogenesis causes a disruption of long-term memory formation and the development of Alzheimer's disease.

Collectively, these studies indicate that PARP-1 and its enzymatic activity play an important role in the epigenetic regulation of rDNA in various aspects of biology. Based on the findings described above, PARP-1 regulates multiple areas of nucleolar function, including (1) establishment of transcriptionally inactive rDNA chromatin, (2) the maintenance of nucleolar integrity and structure, and (3) the regulation of Pol I dependent transcription of the rDNA.

Role of PARP-1 in the regulation of ribosomal biogenesis during DNA damage

Recent studies have shown that PARP-1 activation can regulate rDNA transcription in response to DNA damage (Calkins et al. 2013). DNA replication and rDNA transcription are inhibited following DNA damage mediated by UV light, γ radiation (IR), and cross-linking by cisplatin, resulting in the accumulation of cells in S phase. Inhibition of the DNA repair proteins, DNA-dependent protein kinase (DNA-PK), or PARP-1 prevents cisplatin-induced inhibition of rRNA synthesis (Calkins et al. 2013). This study showed that DNA-PK acts upstream of PARP-1 to recruit PARP-1 to chromatin at sites of DNA damage. Subsequent activation of PARP-1 leads to the inhibition of rRNA synthesis after DNA damage. Thus, DNA-PK-dependent PARP-1 activation may result in the maintenance of inherited silencing of rDNA genes and repression of rRNA synthesis (Fig. 6). However, PARP-1 translocates from the nucleolus to the nucleoplasm in the first 2 h after DNA damage and inhibition of rRNA synthesis has been observed between 12 and 24 h after DNA damage (Calkins et al. 2013). Thus, it is possible that nucleolar exit of PARP-1 after DNA damage, rather than direct silencing of rDNA by PARP-1 in nucleolus, affects the inhibition of rRNA synthesis in this process. Further studies of nucleolar-nucleoplasmic shuttling of PARP-1 after DNA damage are required to elucidate the role of PARP-1 in repression of rRNA synthesis following DNA damage.

DNA damage-induced formation of silent rDNA chromatin. DNA damage leads to the accumulation of cells in S phase, with DNA replication forks stalled at sites of DNA damage. DNA-PK acts upstream of PARP-1 to recruit it to chromatin. Subsequent PARP-1 activation plays an essential role in the formation of silent rDNA chromatin at the time of replication.

Another possible mechanism by which PARP-1 could facilitate repression of rRNA synthesis is through direct or indirect interaction with target proteins with roles in rDNA transcription. For example, TARG1 localizes to transcriptionally active nucleoli through direct interaction with rRNA, as well as rRNA processing and ribosomal assembly factors, independent of ADPRylation (Bütepage et al. 2018). Interestingly, TARG1's nucleolar localization is abrogated by inhibition of rRNA transcription, indicating that TARG1 may function as a key regulator of rRNA synthesis. In addition, TARG1 relocalizes to the nucleoplasm upon DNA damage-induced PARP-1/PARP-2-dependent PARylation. TARG1 is mainly localized to the nucleolus in the absence of PAR, while it accumulates in the nucleoplasm in response to DNA damage-dependent PAR formation, indicating that TARG1 localization is strongly regulated by PARylation. These findings suggest that DNA damage-induced PARylation might serve to sequester TARG1 to the nucleoplasm, resulting in the loss of nucleolar function of TARG1 in rRNA synthesis (Bütepage et al. 2018).


Contents

RNA and DNA have distinct chemical properties Edit

When first studied in the early 1900s, the chemical and biological differences between RNA and DNA were not apparent, and they were named after the materials from which they were isolated RNA was initially known as "yeast nucleic acid" and DNA was "thymus nucleic acid". [1] Using diagnostic chemical tests, carbohydrate chemists showed that the two nucleic acids contained different sugars, whereupon the common name for RNA became "ribose nucleic acid". Other early biochemical studies showed that RNA was readily broken down at high pH, while DNA was stable (although denatured) in alkali. Nucleoside composition analysis showed first that RNA contained similar nucleobases to DNA, with uracil instead of thymine, and that RNA contained a number of minor nucleobase components, e.g. small amounts of pseudouridine and dimethylguanine. [2]

Localization in cell and morphogenetic role Edit

In 1933, while studying virgin sea urchin eggs, Jean Brachet suggested that DNA is found in cell nucleus and that RNA is present exclusively in the cytoplasm. At the time, "yeast nucleic acid" (RNA) was thought to occur only in plants, while "thymus nucleic acid" (DNA) only in animals. The latter was thought to be a tetramer, with the function of buffering cellular pH. [3] [4] During the 1930s, Joachim Hämmerling conducted experiments with Acetabularia in which he began to distinguish the contributions of the nucleus and the cytoplasm substances (later discovered to be DNA and mRNA, respectively) to cell morphogenesis and development. [5] [6]

Messenger RNA (mRNA) carries genetic information that directs protein synthesis Edit

The concept of messenger RNA emerged during the late 1950s, and is associated with Crick's description of his "Central Dogma of Molecular Biology", which asserted that DNA led to the formation of RNA, which in turn led to the synthesis of proteins. During the early 1960s, sophisticated genetic analysis of mutations in the lac operon of E. coli and in the rII locus of bacteriophage T4 were instrumental in defining the nature of both messenger RNA and the genetic code. The short-lived nature of bacterial RNAs, together with the highly complex nature of the cellular mRNA population, made the biochemical isolation of mRNA very challenging. This problem was overcome in the 1960s by the use of reticulocytes in vertebrates, [7] which produce large quantities of mRNA that are highly enriched in RNA encoding alpha- and beta-globin (the two major protein chains of hemoglobin). [8] The first direct experimental evidence for the existence of mRNA was provided by such a hemoglobin synthesizing system. [9]

Ribosomes make proteins Edit

In the 1950s, results of labeling experiments in rat liver showed that radioactive amino acids were found to be associated with "microsomes" (later redefined as ribosomes) very rapidly after administration, and before they became widely incorporated into cellular proteins. Ribosomes were first visualized using electron microscopy, and their ribonucleoprotein components were identified by biophysical methods, chiefly sedimentation analysis within ultracentrifuges capable of generating very high accelerations (equivalent to hundreds of thousands times gravity). Polysomes (multiple ribosomes moving along a single mRNA molecule) were identified in the early 1960s, and their study led to an understanding of how ribosomes proceed to read the mRNA in a 5′ to 3′ direction, [10] processively generating proteins as they do so. [11]

Transfer RNA (tRNA) is the physical link between RNA and protein Edit

Biochemical fractionation experiments showed that radioactive amino acids were rapidly incorporated into small RNA molecules that remained soluble under conditions where larger RNA-containing particles would precipitate. These molecules were termed soluble (sRNA) and were later renamed transfer RNA (tRNA). Subsequent studies showed that (i) every cell has multiple species of tRNA, each of which is associated with a single specific amino acid, (ii) that there are a matching set of enzymes responsible for linking tRNAs with the correct amino acids, and (iii) that tRNA anticodon sequences form a specific decoding interaction with mRNA codons. [12]

The genetic code is solved Edit

The genetic code consists of the translation of particular nucleotide sequences in mRNA to specific amino acid sequences in proteins (polypeptides). The ability to work out the genetic code emerged from the convergence of three different areas of study--(i) new methods to generate synthetic RNA molecules of defined composition to serve as artificial mRNAs, (ii) development of in vitro translation systems that could be used to translate the synthetic mRNAs into protein, and (iii) experimental and theoretical genetic work which established that the code was written in three letter "words" (codons). Today, our understanding of the genetic code permits the prediction of the amino sequence of the protein products of the tens of thousands of genes whose sequences are being determined in genome studies. [13]

RNA polymerase is purified Edit

The biochemical purification and characterization of RNA polymerase from the bacterium Escherichia coli enabled the understanding of the mechanisms through which RNA polymerase initiates and terminates transcription, and how those processes are regulated to regulate gene expression (i.e. turn genes on and off). Following the isolation of E. coli RNA polymerase, the three RNA polymerases of the eukaryotic nucleus were identified, as well as those associated with viruses and organelles. Studies of transcription also led to the identification of many protein factors that influence transcription, including repressors, activators and enhancers. The availability of purified preparations of RNA polymerase permitted investigators to develop a wide range of novel methods for studying RNA in the test tube, and led directly to many of the subsequent key discoveries in RNA biology. [14]

First complete nucleotide sequence of a biological nucleic acid molecule Edit

Although determining the sequence of proteins was becoming somewhat routine, methods for sequencing of nucleic acids were not available until the mid-1960s. In this seminal work, a specific tRNA was purified in substantial quantities, and then sliced into overlapping fragments using a variety of ribonucleases. Analysis of the detailed nucleotide composition of each fragment provided the information necessary to deduce the sequence of the tRNA. Today, the sequence analysis of much larger nucleic acid molecules is highly automated and enormously faster. [15]

Evolutionary variation of homologous RNA sequences reveals folding patterns Edit

Additional tRNA molecules were purified and sequenced. The first comparative sequence analysis was done and revealed that the sequences varied through evolution in such a way that all of the tRNAs could fold into very similar secondary structures (two-dimensional structures) and had identical sequences at numerous positions (e.g. CCA at the 3′ end). The radial four-arm structure of tRNA molecules is termed the 'cloverleaf structure', and results from the evolution of sequences with common ancestry and common biological function. Since the discovery of the tRNA cloverleaf, comparative analysis of numerous other homologous RNA molecules has led to the identification of common sequences and folding patterns. [16]

First complete genomic nucleotide sequence Edit

The 3569 nucleotide sequence of all of the genes of the RNA bacteriophage MS2 was determined by a large team of researchers over several years, and was reported in a series of scientific papers. These results enabled the analysis of the first complete genome, albeit an extremely tiny one by modern standards. Several surprising features were identified, including genes that partially overlap one another and the first clues that different organisms might have slightly different codon usage patterns. [17]

Reverse transcriptase can copy RNA into DNA Edit

Retroviruses were shown to have a single-stranded RNA genome and to replicate via a DNA intermediate, the reverse of the usual DNA-to-RNA transcription pathway. They encode a RNA-dependent DNA polymerase (reverse transcriptase) that is essential for this process. Some retroviruses can cause diseases, including several that are associated with cancer, and HIV-1 which causes AIDS. Reverse transcriptase has been widely used as an experimental tool for the analysis of RNA molecules in the laboratory, in particular the conversion of RNA molecules into DNA prior to molecular cloning and/or polymerase chain reaction (PCR). [18]

RNA replicons evolve rapidly Edit

Biochemical and genetic analyses showed that the enzyme systems that replicate viral RNA molecules (reverse transcriptases and RNA replicases) lack molecular proofreading (3′ to 5′ exonuclease) activity, and that RNA sequences do not benefit from extensive repair systems analogous to those that exist for maintaining and repairing DNA sequences. Consequently, RNA genomes appear to be subject to significantly higher mutation rates than DNA genomes. For example, mutations in HIV-1 that lead to the emergence of viral mutants that are insensitive to antiviral drugs are common, and constitute a major clinical challenge. [19]

Ribosomal RNA (rRNA) sequences provide a record of the evolutionary history of all life forms Edit

Analysis of ribosomal RNA sequences from a large number of organisms demonstrated that all extant forms of life on Earth share common structural and sequence features of the ribosomal RNA, reflecting a common ancestry. Mapping the similarities and differences among rRNA molecules from different sources provides clear and quantitative information about the phylogenetic (i.e. evolutionary) relationships among organisms. Analysis of rRNA molecules led to the identification of a third major kingdom of organisms, the archaea, in addition to the prokaryotes and eukaryotes. [20]

Non-encoded nucleotides are added to the ends of RNA molecules Edit

Molecular analysis of mRNA molecules showed that, following transcription, mRNAs have non-DNA-encoded nucleotides added to both their 5′ and 3′ ends (guanosine caps and poly-A, respectively). Enzymes were also identified that add and maintain the universal CCA sequence on the 3′ end of tRNA molecules. These events are among the first discovered examples of RNA processing, a complex series of reactions that are needed to convert RNA primary transcripts into biologically active RNA molecules. [21]

Small RNA molecules are abundant in the eukaryotic nucleus Edit

Small nuclear RNA molecules (snRNAs) were identified in the eukaryotic nucleus using immunological studies with autoimmune antibodies, which bind to small nuclear ribonucleoprotein complexes (snRNPs complexes of the snRNA and protein). Subsequent biochemical, genetic, and phylogenetic studies established that many of these molecules play key roles in essential RNA processing reactions within the nucleus and nucleolus, including RNA splicing, polyadenylation, and the maturation of ribosomal RNAs. [22]

RNA molecules require a specific, complex three-dimensional structure for activity Edit

The detailed three-dimensional structure of tRNA molecules was determined using X-ray crystallography, and revealed highly complex, compact three dimensional structures consisting of tertiary interactions laid upon the basic cloverleaf secondary structure. Key features of tRNA tertiary structure include the coaxial stacking of adjacent helices and non-Watson-Crick interactions among nucleotides within the apical loops. Additional crystallographic studies showed that a wide range of RNA molecules (including ribozymes, riboswitches and ribosomal RNA) also fold into specific structures containing a variety of 3D structural motifs. The ability of RNA molecules to adopt specific tertiary structures is essential for their biological activity, and results from the single-stranded nature of RNA. In many ways, RNA folding is more highly analogous to the folding of proteins rather than to the highly repetitive folded structure of the DNA double helix. [12]

Genes are commonly interrupted by introns that must be removed by RNA splicing Edit

Analysis of mature eukaryotic messenger RNA molecules showed that they are often much smaller than the DNA sequences that encode them. The genes were shown to be discontinuous, composed of sequences that are not present in the final mature RNA (introns), located between sequences that are retained in the mature RNA (exons). Introns were shown to be removed after transcription through a process termed RNA splicing. Splicing of RNA transcripts requires a highly precise and coordinated sequence of molecular events, consisting of (a) definition of boundaries between exons and introns, (b) RNA strand cleavage at exactly those sites, and (c) covalent linking (ligation) of the RNA exons in the correct order. The discovery of discontinuous genes and RNA splicing was entirely unexpected by the community of RNA biologists, and stands as one of the most shocking findings in molecular biology research. [23]

Alternative pre-mRNA splicing generates multiple proteins from a single gene Edit

The great majority of protein-coding genes encoded within the nucleus of metazoan cells contain multiple introns. In many cases, these introns were shown to be processed in more than one pattern, thus generating a family of related mRNAs that differ, for example, by the inclusion or exclusion of particular exons. The end result of alternative splicing is that a single gene can encode a number of different protein isoforms that can exhibit a variety of (usually related) biological functions. Indeed, most of the proteins encoded by the human genome are generated by alternative splicing. [24]

Discovery of catalytic RNA (ribozymes) Edit

An experimental system was developed in which an intron-containing rRNA precursor from the nucleus of the ciliated protozoan Tetrahymena could be spliced in vitro. Subsequent biochemical analysis shows that this group I intron was self-splicing that is, the precursor RNA is capable of carrying out the complete splicing reaction in the absence of proteins. In separate work, the RNA component of the bacterial enzyme ribonuclease P (a ribonucleoprotein complex) was shown to catalyze its tRNA-processing reaction in the absence of proteins. These experiments represented landmarks in RNA biology, since they revealed that RNA could play an active role in cellular processes, by catalyzing specific biochemical reactions. Before these discoveries, it was believed that biological catalysis was solely the realm of protein enzymes. [25] [26]

RNA was likely critical for prebiotic evolution Edit

The discovery of catalytic RNA (ribozymes) showed that RNA could both encode genetic information (like DNA) and catalyze specific biochemical reactions (like protein enzymes). This realization led to the RNA World Hypothesis, a proposal that RNA may have played a critical role in prebiotic evolution at a time before the molecules with more specialized functions (DNA and proteins) came to dominate biological information coding and catalysis. Although it is not possible for us to know the course of prebiotic evolution with any certainty, the presence of functional RNA molecules with common ancestry in all modern-day life forms is a strong argument that RNA was widely present at the time of the last common ancestor. [27]

Introns can be mobile genetic elements Edit

Some self-splicing introns can spread through a population of organisms by "homing", inserting copies of themselves into genes at sites that previously lacked an intron. Because they are self-splicing (that is, they remove themselves at the RNA level from genes into which they have inserted), these sequences represent transposons that are genetically silent, i.e. they do not interfere with the expression of the gene into which they become inserted. These introns can be regarded as examples of selfish DNA. Some mobile introns encode homing endonucleases, enzymes that initiate the homing process by specifically cleaving double-stranded DNA at or near the intron-insertion site of alleles lacking an intron. Mobile introns are frequently members of either the group I or group II families of self-splicing introns. [28]

Spliceosomes mediate nuclear pre-mRNA splicing Edit

Introns are removed from nuclear pre-mRNAs by spliceosomes, large ribonucleoprotein complexes made up of snRNA and protein molecules whose composition and molecular interactions change during the course of the RNA splicing reactions. Spliceosomes assemble on and around splice sites (the boundaries between introns and exons in the unspliced pre-mRNA) in mRNA precursors and use RNA-RNA interactions to identify critical nucleotide sequences and, probably, to catalyze the splicing reactions. Nuclear pre-mRNA introns and spliceosome-associated snRNAs show similar structural features to self-splicing group II introns. In addition, the splicing pathway of nuclear pre-mRNA introns and group II introns shares a similar reaction pathway. These similarities have led to the hypothesis that these molecules may share a common ancestor. [29]

RNA sequences can be edited within cells Edit

Messenger RNA precursors from a wide range of organisms can be edited before being translated into protein. In this process, non-encoded nucleotides may be inserted into specific sites in the RNA, and encoded nucleotides may be removed or replaced. RNA editing was first discovered within the mitochondria of kinetoplastid protozoans, where it has been shown to be extensive. [30] For example, some protein-coding genes encode fewer than 50% of the nucleotides found within the mature, translated mRNA. Other RNA editing events are found in mammals, plants, bacteria and viruses. These latter editing events involve fewer nucleotide modifications, insertions and deletions than the events within kinetoplast DNA, but still have high biological significance for gene expression and its regulation. [31]

Telomerase uses a built-in RNA template to maintain chromosome ends Edit

Telomerase is an enzyme that is present in all eukaryotic nuclei which serves to maintain the ends of the linear DNA in the linear chromosomes of the eukaryotic nucleus, through the addition of terminal sequences that are lost in each round of DNA replication. Before telomerase was identified, its activity was predicted on the basis of a molecular understanding of DNA replication, which indicated that the DNA polymerases known at that time could not replicate the 3′ end of a linear chromosome, due to the absence of a template strand. Telomerase was shown to be a ribonucleoprotein enzyme that contains an RNA component that serves as a template strand, and a protein component that has reverse transcriptase activity and adds nucleotides to the chromosome ends using the internal RNA template. [32]

Ribosomal RNA catalyzes peptide bond formation Edit

For years, scientists had worked to identify which protein(s) within the ribosome were responsible for peptidyl transferase function during translation, because the covalent linking of amino acids represents one of the most central chemical reactions in all of biology. Careful biochemical studies showed that extensively-deproteinized large ribosomal subunits could still catalyze peptide bond formation, thereby implying that the sought-after activity might lie within ribosomal RNA rather than ribosomal proteins. Structural biologists, using X-ray crystallography, localized the peptidyl transferase center of the ribosome to a highly-conserved region of the large subunit ribosomal RNA (rRNA) that is located at the place within the ribosome where the amino-acid-bearing ends of tRNA bind, and where no proteins are present. These studies led to the conclusion that the ribosome is a ribozyme. The rRNA sequences that make up the ribosomal active site represent some of the most highly conserved sequences in the biological world. Together, these observations indicate that peptide bond formation catalyzed by RNA was a feature of the last common ancestor of all known forms of life. [33]

Combinatorial selection of RNA molecules enables in vitro evolution Edit

Experimental methods were invented that allowed investigators to use large, diverse populations of RNA molecules to carry out in vitro molecular experiments that utilized powerful selective replication strategies used by geneticists, and which amount to evolution in the test tube. These experiments have been described using different names, the most common of which are "combinatorial selection", "in vitro selection", and SELEX (for Systematic Evolution of Ligands by Exponential Enrichment). These experiments have been used for isolating RNA molecules with a wide range of properties, from binding to particular proteins, to catalyzing particular reactions, to binding low molecular weight organic ligands. They have equal applicability to elucidating interactions and mechanisms that are known properties of naturally occurring RNA molecules to isolating RNA molecules with biochemical properties that are not known in nature. In developing in vitro selection technology for RNA, laboratory systems for synthesizing complex populations of RNA molecules were established, and used in conjunction with the selection of molecules with user-specified biochemical activities, and in vitro schemes for RNA replication. These steps can be viewed as (a) mutation, (b) selection, and (c) replication. Together, then, these three processes enable in vitro molecular evolution. [34]

Many mobile DNA elements use an RNA intermediate Edit

Transposable genetic elements (transposons) are found which can replicate via transcription into an RNA intermediate which is subsequently converted to DNA by reverse transcriptase. These sequences, many of which are likely related to retroviruses, constitute much of the DNA of the eukaryotic nucleus, especially so in plants. Genomic sequencing shows that retrotransposons make up 36% of the human genome and over half of the genome of major cereal crops (wheat and maize). [35]

Riboswitches bind cellular metabolites and control gene expression Edit

Segments of RNA, typically embedded within the 5′-untranslated region of a vast number of bacterial mRNA molecules, have a profound effect on gene expression through a previously-undiscovered mechanism that does not involve the participation of proteins. In many cases, riboswitches change their folded structure in response to environmental conditions (e.g. ambient temperature or concentrations of specific metabolites), and the structural change controls the translation or stability of the mRNA in which the riboswitch is embedded. In this way, gene expression can be dramatically regulated at the post-transcriptional level. [36]

Small RNA molecules regulate gene expression by post-transcriptional gene silencing Edit

Another previously unknown mechanism by which RNA molecules are involved in genetic regulation was discovered in the 1990s. Small RNA molecules termed microRNA (miRNA) and small interfering RNA (siRNA) are abundant in eukaryotic cells and exert post-transcriptional control over mRNA expression. They function by binding to specific sites within the mRNA and inducing cleavage of the mRNA via a specific silencing-associated RNA degradation pathway. [37]

Noncoding RNA controls epigenetic phenomena Edit

In addition to their well-established roles in translation and splicing, members of noncoding RNA (ncRNA) families have recently been found to function in genome defense and chromosome inactivation. For example, piwi-interacting RNAs (piRNAs) prevent genome instability in germ line cells, while Xist (X-inactive-specific-transcript) is essential for X-chromosome inactivation in mammals. [38]


Recent advances in biopharmaceuticals have expanded the range of therapeutic targets for a variety of human diseases. RNA-target therapies have received widespread attention for their potential to treat a variety of chronic and rare diseases, and address targets that have proven to be intractable to antibody and small-molecule approaches. Despite the many obstacles encountered in this process, more than 50 RNA or RNA-derived therapeutic agents have been clinically tested. These include oligonucleotides (ASO), small interfering RNAs (siRNAs), microRNAs, mRNAs and aptamers.

Figure 1. RNA-based strategies to generate new types of therapeutics in a variety of diseases

To date, RNA-targeting therapeutics are already being applied in various diseases including cancers, genetic disorders and viral infections.

In terms of cancer targeting, therapeutic modalities have been developed involving either short non-coding RNAs (siRNA or miRNA) or IVT mRNA. RNA-based cancer treatment could be achieved by targeting diverse signal pathways related to tumor growth and spreading including carcinogenesis, cell cycle regulation, anti-apoptosis pathway, multidrug resistance, angiogenesis, and cancer metastasis.

Many genetic diseases result from errors that lead to anomalies in transcription, splicing, or translation, for example, spinal muscular atrophy (SMA). Targeting the flawed protein products directly is often ineffective. In many cases, RNA-target therapeutics offer the prospect of resolving the inborn error by normalizing splicing or by suppressing or promoting translation.

RNA-based therapeutics has been suggested as one of the most innovative approaches to derive an advance in the field of drug and vaccine development against the infectious disease. For example, siRNA-mediated therapeutics has been applied in targeting RNAs of virus, including respiratory syncytial virus (RSV), HIV-1, rotavirus, HBV, and influenza virus.

Challenges of RNA-target therapeutics:

  • Intracellular delivery across cell and endosomal membranes
  • Poor pharmacokinetic properties, partly due to urinary excretion and ubiquitous RNases
  • Activation of innate immune nucleic acid sensors
  • Off-target effects

The goal of the IntegrateRNA is to support basic and applied research in RNA biology to generate new and novel insights into the role of RNA in health and disease and provide new tools and targets for RNA research, diagnostics and therapies. For further information, please feel free to contact us.


How are RNA made?

This is the function of the common three forms of RNA, but in the last two decades, scientists have uncovered a Pandora&rsquos box of different RNAs that aren&rsquot directly involved in protein synthesis. These RNAs are broadly dubbed &ldquonon-coding RNA&rdquo (ncRNA).

These small RNA (sRNA) are made of 18 to 30 nucleotides, and consist of various subtypes, such as microRNA (miRNA), small interfering RNA (siRNA) and piwi-interacting RNA (piRNA). There is unusually shaped RNA like hairpin RNAs and circular RNAs. There are RNAs for the nucleus, nucleolus, cytoplasm and even for outside the cell. There are RNAs that are derived from transposons and viruses, and finally, there are the big three involved in protein synthesis. The question is&hellip Why are there so many other RNA types and what do they do in the cells?

The process of translation: the ribosome making a protein using the mRNA transcript. (Photo Credit : TATLE/Shutterstock)


RESULTS AND DISCUSSION

Prokaryotic posttranscriptional regulation by and large employs mechanisms that function to stabilize or destabilize mRNA. Regulation of gene expression by small non-coding regulatory RNAs (sRNA) is an emerging paradigm in microbiology. The current understanding of sRNA regulatory systems, described in several recent reviews (Vogel & Wagner, 2007, Sharma & Vogel, 2009, Beisel & Storz, 2010, Richards & Vanderpool, 2011, Storz, et al., 2011, Vanderpool, et al., 2011, Bossi, et al., 2012, Richter & Backofen, 2012, Shao & Bassler, 2012, Sobrero & Valverde, 2012), generalize that most bacterial sRNAs (like eukaryotic microRNA) regulate expression at the posttranscriptional level, usually by binding multiple target mRNA(s). Typically, the size of bacterial sRNAs ranges from 50 nt to 250 nt. Bacterial sRNA transcripts typically contain their own promoters and Rho-independent terminators. Cis-encoded sRNAs are fully complementary antisense regulatory RNAs encoded within the target mRNA’s ORF, leader, or trailer sequence. Trans-encoded (intergenic) sRNAs bind to target mRNA(s) by imperfect base pairing, dependent on the sRNA’s secondary structure. A single sRNA may repress and/or activate translation. Most chromosomally located sRNAs currently characterized in bacteria are trans-encoded and their mRNA target(s) are not simply determined by sequence analysis or relative loci within the genome.

Pg encounters many different environmental conditions during colonization and growth within the host that require integration of sensory input and coordination of complex mechanisms of gene regulation. We hypothesized that Pg employ sRNA regulatory elements to rapidly respond to environmental cues. We used NimbleGen microarray analysis to identify transcripts found in cDNA libraries generated from small RNA enriched Pg W83 samples expressed in response to growth phase and/or hemin availability, after two days of hemin starvation. These conditions were selected based on published studies that suggest that periodontal pathogenesis is initiated during mid-log phase under hemin limitation after hemin starvation (Genco, et al., 1993, Kesavalu, et al., 2003, Kiyama-Kishikawa, et al., 2005, Dashper, et al., 2009). Following hybridization, microarrays were scanned and the median signal intensity for each probe on the array calculated by NimbleGen. A region was considered to contain a small transcript if four or more probes in succession were greater than 10-fold above background (signal intensity 㸐,000). This corresponds to RNA of about 75 bp or larger. Each small transcript was analyzed for the presence of a transcription terminator based on the prediction program TransTermHP (http://transterm.cbcb.umd.edu/). Transcripts containing a predicted terminator were analyzed to determine the location on the genome, the presence of an open reading frame (ORF), and its length estimated based on the first and last positive probe. Only those transcripts larger than 70 nt containing a predicted terminator and did not contain an ORF on the same strand were considered candidate sRNA. Approximately 8 % of the 180,071 probes covering the entire 2.34 Mbp Pg W83 genome were highly expressed. Thirty-seven putative sRNAs were identified whose terminators could be predicted and is summarized as follows (Table S5): Thirty mapped to IGSs. Three mapped to IGSs with slight ORF 5′ overlap on the opposite strand based on terminator prediction. Four mapped to ORF on the opposite strand based on terminator prediction. All but thirteen putative sRNAs were regulated in response to limited hemin availability after hemin starvation. Those transcripts identified by microarray that also had significant counts detected by RNA-seq analysis are indicated in Table S5.

Mobile genetic elements contribute to the genetic plasticity of bacterial species (Tribble, et al., 2007, Naito, et al., 2011, Watanabe, et al., 2013). There are numerous short and long mobile elements including complete and degenerative (truncated) insertion sequences (IS) and transposons found throughout the genome of Pg. Studies to date have shown that Pg has a high degree of genetic variation among strains. For example, conjugal transfer is proposed to be the mechanism by which Pg undergoes allele exchange, contributing to genetic variation (Tribble, et al., 2007, Naito, et al., 2011). Using RNA-seq analysis, we found that all five ISPg3 and all ten ISPg4 transposase ORFs encoded highly expressed cis-encoded antisense transcripts to the 5′ untranslated region (UTR) of these genes with a 2nt overlap of coding region. We also identified cis-encoded antisense transcripts to both ORFs (PG0827, PG1446) encoding putative MatE family multidrug efflux pumps ( Figure 1 ). These genes were located within regions flanked by integrases. Sequence analyses indicate that these regions are located within large multi-gene transposons. We also identified highly expressed transcripts of CRISPR regulatory sRNA trans-encoded in the IGS upstream of CRISPR-associated (CAS) gene arrays. A recent study analyzing the spacer content among the genomes of 60 Pg isolates has indicated that IS mediated transposition may be limited by CRISPR interference (Watanabe, et al., 2013). Spacer analysis showed a high degree of similarity to Pg genome sequence, most of which matched sequences within ORFs. We found that inverted repeats of ISPg1 type transposases appear associated with CRISPRs in W83. The identification of these highly expressed sRNA transcripts indicate another mechanism Pg employ to limit genetic exchange among a population with a genotype clearly predisposed to a high degree of genetic exchange. CRISPR expression was only detected under logarithmic growth and not during stationary, indicating that Pg uses this mechanism to limit genetic exchange only during active growth phase. In contrast, the cis-encoded antisense transcripts to ISPg3s and ISPg4s UTRs and the MatE efflux pump ORFs were expressed under all conditions assayed.

The 5′ end (GTCCAAGTACATTCTTATCGTTGG) of the identified antisense transcripts is centrally located within their respective Pg ORFs encoding MatE family multi-drug efflux pumps. PG0827 and PG1446 are indicated by red shading. ORFs encoding ISPg1 transposase are indicated by blue shading. Truncated ORFs are indicated by grey shading. ORFs encoding integrases are indicated by crosshatching. The homologous regions between these loci were directionally aligned and box outlined in this graphic representation.

Overall, we identified 186 sites containing 5′ end sequence reads, other than tRNA or rRNA, with significant counts (ϥ) that mapped to IGSs or were clearly antisense to identified ORFs on the Pg W83 genome. Transcripts from approximately 49 % of these sites (not encoding tRNA/rRNA) were highly expressed (㸐 counts). Of the sequenced reads within the pooled cDNA, consisting of 6 libraries, approximately 85 % of the mapped reads were to tRNA/rRNA for all culture conditions (i.e., 107773/141115 of library containing 5′ reads with barcode #1 Supplement data). Under these parameters, read depth of the sample was limited, thus greater than 10 counts of the same transcript was considered highly expressed. The expression profile was determined by normalizing the sequencing read counts of each analyzed transcript to the relative tRNA/rRNA counts within each library. Twenty-three putative sRNAs were clearly regulated in response to growth phase. Twenty-two putative sRNAs located within IGSs were clearly up-regulated in response to hemin after hemin starvation (Table S6). Northern analysis was performed on several of the small RNA transcripts that had high microarray signal intensity. For example, a transcript (sRNA 101) approximately 118nt, encoded on the negative strand of the IGS between PG2089 and PG2090 (both encoded on the positive strand), was detected by microarray. This transcript had a maximal count of 88 5′-end sequence reads (ATAAGCCGCACTGTTAGATCGGGG) as detected by RNA-seq analysis. Northern analysis confirmed expression of this IGS encoded transcript ( Figure 2 ). In contrast, microarray analysis detected a transcript mapping to the positive strand of the IGS between PG0715 and PG0717 (sRNA 42) that had high signal intensity, while none was detected by RNA-seq nor Northern analysis ( Figure 2 ). We believe RNA-seq analysis is an improved method to determine relative expression profiles of microbial sRNA compared to microarray. We propose that an additional alteration in the methodology to reduce tRNA in library generation would improve sRNA transcript identification by RNA-seq analysis, but may eliminate the ability to generate comparable relative expression profiles normalized to tRNA read counts.

Microarray signal intensity graphs (A) and Northern blot autoradiographic image (10min exposure) (B). The lanes were loaded with molecular weight marker (L) and small RNA enriched, DNase digested, RNA isolated from hemin-limiting stationary (H), hemin-excess mid-log (M), or hemin-excess stationary (S), Pg culture condition (after two day hemin pre-starvation).


Watch the video: 16s rRNA (December 2021).