Information

Why is an excess number of eosinophils consistent with a violent allergic reaction?


What roles do eosinophils play in allergic reaction?


The primary function of Eosinophils is to releas digestive enzymes and destroy extracellular parasites, but they also contain pro-inflammatory molecules and cytokines in their granules.

Eosinophils play an important role in late response inflammation. The primary inflammation is caused by degranulation of improper hyperactivation of mast cells when they encounter antigen/allergen (They have IgE bound to their receptors on a membrane). They release cytokines as IL-4 and IL-13 which recruit Th2 lymphocytes. Th2 lymphocytes release i.e. IL-5 which attract eosinophils.

Eosinophils release the content of their granules, which can degrade the tissue on an organism. Their cytokines attract more WBC - eosinophils (macrophages, TH2 lymphocytes and mast cells) and since this process is not controlled, they accumulate in tissues and it can lead to allergic reaction.

Good book contemplating this topic


Allergic rhinitis

Allergic rhinitis (AR) is caused by immunoglobulin E (IgE)-mediated reactions to inhaled allergens and is one of the most common chronic conditions globally. AR often co-occurs with asthma and conjunctivitis and is a global health problem causing major burden and disability worldwide. Risk factors include inhalant and occupational allergens, as well as genetic factors. AR impairs quality of life, affects social life, school and work, and is associated with substantial economic costs. The Allergic Rhinitis and its Impact on Asthma (ARIA) initiative classified AR into intermittent or persistent and mild or moderate/severe. The diagnosis is based on the clinical history and, if needed in patients with uncontrolled rhinitis despite medications or with long-lasting symptoms, on skin tests or the presence of serum-specific IgE antibodies to allergens. The most frequently used pharmacological treatments include oral, intranasal or ocular H1-antihistamines, intranasal corticosteroids or a fixed combination of intranasal H1-antihistamines and corticosteroids. Allergen immunotherapy prescribed by a specialist using high-quality extracts in stratified patients is effective in patients with persistent symptoms. Real-world data obtained by mobile technology offer new insights into AR phenotypes and management. The outlook for AR includes a better understanding of novel multimorbid phenotypes, health technology assessment and patient-centred shared decision-making.


Materials and methods

Lipopolysaccharide, lipid A, and lipid A partial structure

LPS was prepared from Salmonella friedenau and purified by the phenol-chloroform-petroleum ether method.31,32 This preparation contains less than 0.2% protein and nucleic acid as determined by chemical analysis. Lipid A was obtained from the Escherichia coli Re-mutant strain F515 by treating phenol-chloroform-petroleum ether-extracted LPS with acetate buffer.32 LPS as well as lipid A was kindly provided by H. Brade (Research Center Borstel, Borstel, Germany). Synthetic compound 406 (precursor Ia), which represents a tetraacyl partial structure of E coli-lipid A lacking dodecanoic and tetradecanoic acids, was synthesized as described previously.33 Compound 406 was a kind gift of S. Kusumoto (Osaka University, Osaka, Japan).

3 H-LPS was biosynthetic radiolabeled and isolated from theE coli K-12 strain LCD25.34 This preparation was obtained from LIST Biological Laboratories, Campbell.

Reagents and antibodies

Unless otherwise indicated, all fine chemicals were purchased from Sigma (Deisenhofen, Germany), Serva (Heidelberg, Germany), or Pharmingen (San Diego, CA). The CD14-specific moAb used was MEM-18 (Immunoglobulin IgG1)2 and was a kind gift from V. Horejsi (Institute of Molecular Genetics, Academy of Sciences of the Czech Republic, Prague, Czech Republic) purified mouse IgG1 (Sigma) was used as the isotype control. Normal human sera were obtained from healthy volunteers.

Eosinophil isolation

Blood was drawn from healthy nonatopic volunteers and separated by density gradient centrifugation with Ficoll-Isopaque (Pharmacia, Freiburg, Germany). The bottom layer containing neutrophils, eosinophils, and erythrocytes was harvested. Erythrocytes were eliminated by hypotonic lysis. Granulocytes were resuspended in phosphate-buffered saline–bovine serum albumin (PBS-BSA) 0.4%, washed, and incubated for 40 minutes at 4°C with anti-CD16–conjugated micromagnetic beads (Miltenyi Biotec GmbH, Bergisch-Gladbach, Germany). On passing through the magnetic column (MACS, Miltenyi Biotec GmbH), neutrophils bound to the beads were retained within the column, whereas eosinophils were passed through and collected. In each preparation, an eosin stain of the cells, which is specific for eosinophils, was performed on a cytospin smear containing a count of at least 500 cells to ensure pure eosinophil preparation. The purification procedure resulted in a highly purified preparation of eosinophils (more than 98%).

Isolation of peripheral blood mononuclear cells and monocytes

Peripheral blood mononuclear cells (PBMCs) from healthy donors were obtained from the top layer after density gradient centrifugation on Ficoll-Isopaque (Pharmacia). After repeated washing in HBSS (Biochrom, Berlin, Germany), monocytes were isolated by counterflow elutriation using the JE-6B elutriator system (Beckmann Instruments, Palo Alto, CA) as described previously.35

TNF-α and eosinophil cationic protein release in human eosinophils

Cell cultures were performed in RPMI 1640 medium (Biochrom) supplemented with 10% human serum, 100 U/mL penicillin, and 100 μg/mL streptomycin.

For the stimulation experiments, eosinophils (2 × 10 6 /mL) were treated with LPS or lipid A for 16 hours at 37°C (under 5% CO2) in 200-μL cultures (triplicate wells) in U-form microtiter plates (Greiner, Nürtingen, Germany). For inhibition studies, anti-CD14 moAb (MEM-18) or the antagonistic compound 406 was added at 4°C to the cells for 20 minutes before stimulation with LPS or lipid A. After incubation, supernatants were harvested and analyzed for cytokine activity or ECP content. The concentration of TNF-α in supernatants was determined by enzyme-linked immunosorbent assay (ELISA). ECP content in supernatants was measured with the RIA kit (Pharmacia) as described by the manufacturer.

Uptake of 3 H-LPS

For determination of 3 H-LPS uptake, eosinophils, PBMCs, or monocytes were seeded in 24-well plates (2 × 10 6 cells/mL). Incubation with 3 H-LPS was performed in the presence of 10% human serum for 1 hour at 37°C, cells were washed 3 times with PBS and lysed in PBS containing 2% SDS. Tritium counting of the lysates was performed in a liquid scintillation counter (Packard). In blocking experiments, eosinophils were pretreated with anti-CD14 moAb (MEM-18), the isotype control IgG1 (Sigma), the antagonistic compound 406, or unlabeled LPS for 30 minutes.

Flow cytometry

Flow cytometric analysis were performed using a FACS-Calibur (Becton Dickinson, Heidelberg, Germany). For immunofluorescent staining, anti-CD14–FITC moAb (My4-FITC IgG2b) from Coulter were used. The cells (10 5 /mL) were washed, resupended in 100 μL of azide-PBS and incubated with the FITC-labeled anti-CD14 antibodies for 30 minutes at 4°C. Incubation was stopped by adding 1.5 mL ice-cold azide-PBS. After washing, the cells were resuspended in 400 μL azide-PBS. Unlabeled cells and cells incubated with the isotype (IgG2b-FITC, Sigma) were used as controls.

Reverse transcriptase-polymerase chain reaction

Eosinophil and monocyte messenger RNA (mRNA) was isolated from 2 × 10 6 cells using oligo-dT magnetic beads (Dynal, Hamburg, Germany), according to the manufacturer's instructions. Synthesis of complementary DNA (cDNA) was performed with Oligo-dT17 as the primer for reverse transcriptase (Superscript, Gibco-BRL, Eggenstein, Germany) in the presence of 650 U/mL RNase-inhibitor. Thirty cycles of amplification of cDNA was conducted in an automatic DNA thermal cycler (Perkin-Elmer Cetus, Norwalk, CT) using an annealing temperature of 52°C (hCD14) or 58°C (hTLR2 and hTLR4). For the amplification of 2 μL cDNA, 200 μM deoxynucleotide triphosphate (Pharmacia), 1.25 units Taq polymerase (Gibco-BRL), and gene-specific sense and antisense primers (1 μM for hCD14, hTLR2, and hTLR4, or 0.1 μM for β-actin) were used at a final volume of 50 μL. PCR primer used were for hCD14 (ACTTATCGACCATGGAGC and AGGCATGGTGCCGGTTA), β-actin (AGCGGGAAATCGTGCGTG and CAGGGTACATGGTGGTGCC), hTLR2 (CACCGTTTCCATGGCCTG and GGACTTTATCGCAGCTCT), and hTLR4 (CTGGCTGCATAAAGTATGGT and ATAGATGTTGCTTCCTGCCA). All PCR products and the molecular weight marker VI (pBR328 DNA × BglI + pBR328 DNA ×HinfI, Boehringer, Mannheim, Germany) were resolved by 1.5% agarose gel electrophoresis, and DNA bands were visualized by staining the gel with 0.01 μg/mL ethidium bromide.

Statistics

Each experiment was performed at least 3 times with cells from different donors. From these experiments, a typical one is shown demonstrating representative results. The results represent the mean ± SD of triplicate cultures. P values, if demonstrated, are estimated by the Student t test.


Chapter 10 - Mast Cell and Eosinophil Proteases in the Chronic Allergic Inflammatory Response

The cleavage of peptides and proteins by proteases is crucial for the maintenance of normal body function, but uncontrolled proteolysis in the tissues can have serious consequences. An imbalance between certain proteases and their inhibitors has long been implicated in the pathogenesis of emphysema as well as in certain other chronic conditions. An increased degree of mast cell activation and increased numbers of eosinophils, frequently in an activated state, have become regarded as some of the defining characteristics of allergic disease. Measurements of tryptase, a serine protease unique to mast cells, histamine and prostaglandin D2 in biological fluids have helped to establish the role of mast cells in such conditions. Thus, tryptase levels are increased in bronchoalveolar lavage (BAL) fluid collected from patients with atopic or intrinsic asthma as well as with certain other respiratory conditions, indicating persistent degranulation of pulmonary mast cells. An increase in BAL fluid concentrations of tryptase has been detected within minutes of the introduction of allergen into the lower airways.


Congenital Lesions: Café au Lait Macules

Café au lait (coffee with milk) macules can be congenital, or they may develop in childhood. These flat macules usually occur on the trunk and can have a smooth or irregular border ( Figure 2 ) . They range from 0.2 to 4 cm in diameter in infants but can reach 30 cm in diameter in adults.3 The hyperpigmentation is caused by increased melanin in melanocytes and basal keratinocytes.4

Smooth border of café au lait macule.

Smooth border of café au lait macule.

Café au lait macules may be a sign of neurofibromatosis. The diagnosis of this disease requires the presence of at least two of seven criteria established at a National Institutes of Health (NIH) consensus development conference (Table 2) .5 The presence of six or more café au lait macules is one of the diagnostic criteria axillary or groin freckling is another ( Figure 3 ) . Hence, the presence of axillary or groin freckling should prompt a search for café au lait macules, and vice versa. If neurofibromatosis is suspected or confirmed, an ophthalmologist can detect optic gliomas and iris hamartomas, which are additional criteria for the diagnosis of neurofibromatosis. The American Academy of Dermatology has practice guidelines based on the NIH definition.5 [Evidence level C, consensus opinion]

Axillary freckling with irregular but discrete border.

Axillary freckling with irregular but discrete border.

Diagnostic Criteria for Neurofibromatosis

Six or more café au lait macules larger than 5 mm in greatest diameter in prepubertal persons and larger than 15 mm in greatest diameter in postpubertal persons

Two or more neurofibromas of any type or one plexiform neurofibroma

Freckling in the axillary or inguinal region

Two or more Lisch nodules (iris hamartomas)

A distinctive osseous lesion such as sphenoid dysplasia or thinning of long bone cortex with or without pseudoarthrosis

A first-degree relative (i.e., parent, sibling, child) with neurofibromatosis type 1 by the above criteria

Information from reference5 .

Diagnostic Criteria for Neurofibromatosis

Six or more café au lait macules larger than 5 mm in greatest diameter in prepubertal persons and larger than 15 mm in greatest diameter in postpubertal persons

Two or more neurofibromas of any type or one plexiform neurofibroma

Freckling in the axillary or inguinal region

Two or more Lisch nodules (iris hamartomas)

A distinctive osseous lesion such as sphenoid dysplasia or thinning of long bone cortex with or without pseudoarthrosis

A first-degree relative (i.e., parent, sibling, child) with neurofibromatosis type 1 by the above criteria

Information from reference5 .

Café au lait macules themselves require treatment only if cosmesis is requested. Surgical or laser treatment by a cosmetic dermatologist may be considered on an individual basis. From a practical standpoint, neurofibromas, which can occur throughout the body, pose more of a cosmetic and functional concern ( Figure 4 ) .

Prominent neurofibromas on the arm.

Prominent neurofibromas on the arm.

Consultation with a geneticist may be prudent because neurofibromatosis is an autosomal dominant condition, although spontaneous mutations cause 50 percent of cases.6 Some patients have café au lait macules without neurofibromatosis their children are not at increased risk for the disease.


Mediator Antagonists

Kian Fan Chung , Peter J. Barnes , in Asthma and COPD (Second Edition) , 2009

Introduction

Inflammatory mediators contribute to the pathophysiology of asthma and chronic obstructive pulmonary disease (COPD) (see Chapters 23–27 Chapter 23 Chapter 24 Chapter 25 Chapter 26 Chapter 27 ) suggesting that antagonists of mediator receptors or inhibitors of their synthesis would be beneficial in treatment. However, because a large number of mediators are involved and many mediators share similar effects on the airways, inhibitors of single mediators may have had little or no clinical benefit to date. This may underlie the fact that despite many years of continuing efforts by pharmaceutical companies, only one class of mediator antagonists, the anti-leukotrienes, has become established in the treatment of asthma, representing the first new class of therapy for asthma introduced in more than 40 years. So far, there has been no mediator antagonists introduced for the treatment of COPD. In addition to reviewing the anti-leukotrienes, we will also review other classes of mediator antagonists that have failed to show beneficial effects or those currently under-investigation but whose potential has yet to be tested.


Results

CD63 protein expression and localization in human peripheral blood eosinophils

The subcellular distribution of CD63 was examined using a combination of immunofluorescent staining and confocal laser scanning microscopy on cytospins of purified peripheral blood eosinophils. Cytospins of freshly purified eosinophils were prepared and immunostained using a monoclonal anti-CD63 antibody. CD63 was expressed in resting peripheral blood eosinophils and appeared predominantly localized to the membrane of all crystalloid granules (Figure1A). The association of CD63 immunoreactivity with crystalloid granule membrane was further confirmed by immunofluorescent staining of a dispersed population of eosinophil crystalloid granules (Figure 1B).

Confocal laser scanning microscopy images of immunostained peripheral blood eosinophils of asthmatic subjects.

Representative images of human eosinophils stained with TRITC-conjugated secondary antibody (red) to detect the MBP as well as RANTES immunoreactivity, or BODIPY-FL–conjugated secondary antibody (green) to detect immunoreactivity against CD63. (A) Resting peripheral blood eosinophils labeled with BODIPY-FL indicating CD63 immunoreactivity. (B) Highly purified crystalloid granules immunostained with anti-CD63. (C) Higher magnification of a combined image of eosinophil crystalloid granules immunostained for MBP (TRITC) indicating core-associated immunoreactivity and CD63 indicating matrix-associated CD63 immunoreactivity. (D) Combined image of double immunofluorescence (MBP and CD63) staining of resting eosinophils red (TRITC) represents immunoreactivity against MBP, and green (BODIPY-FL) is indicative of CD63 immunoreactivity. (E) Combined image of double immunofluorescence (RANTES and CD63) staining of resting eosinophils TRITC detected RANTES, and BODIPY-FL detected CD63. (F-H) Double immunofluorescence (MBP and CD63) staining of IFN-γ–stimulated eosinophils (time = 10 minutes): MBP immunostaining (F), CD63 immunostaining (G), and combined image (H). (I-K) Double immunofluorescence (MBP and CD63) staining of C5a/CB-stimulated eosinophils (time = 10 minutes): MBP immunostaining (I), CD63 immunostaining (J), and combined image (K). (L) Combined image of isotype control for CD63 and MBP immunostaining. (M-O) Double immunofluorescence (MBP and CD63) staining of IL-3/IL-5/GM-CSF–stimulated eosinophils (time = 10 minutes): MBP immunostaining (M), CD63 immunostaining (N), and combined image (O). (P) Combined image of double immunofluorescence (MBP and CD63) staining of IFN-γ–stimulated eosinophils preincubated with genistein (10 −6 M), which inhibited the IFN-γ–induced translocation of CD63. (Q-T) Double immunofluorescence (RANTES and CD63) staining of IFN-γ–stimulated eosinophils: RANTES immunostaining (Q), CD63 immunostaining (R), combined image (S), and DIC image of the same cell (T). Original magnification is × 630 for all images.

Confocal laser scanning microscopy images of immunostained peripheral blood eosinophils of asthmatic subjects.

Representative images of human eosinophils stained with TRITC-conjugated secondary antibody (red) to detect the MBP as well as RANTES immunoreactivity, or BODIPY-FL–conjugated secondary antibody (green) to detect immunoreactivity against CD63. (A) Resting peripheral blood eosinophils labeled with BODIPY-FL indicating CD63 immunoreactivity. (B) Highly purified crystalloid granules immunostained with anti-CD63. (C) Higher magnification of a combined image of eosinophil crystalloid granules immunostained for MBP (TRITC) indicating core-associated immunoreactivity and CD63 indicating matrix-associated CD63 immunoreactivity. (D) Combined image of double immunofluorescence (MBP and CD63) staining of resting eosinophils red (TRITC) represents immunoreactivity against MBP, and green (BODIPY-FL) is indicative of CD63 immunoreactivity. (E) Combined image of double immunofluorescence (RANTES and CD63) staining of resting eosinophils TRITC detected RANTES, and BODIPY-FL detected CD63. (F-H) Double immunofluorescence (MBP and CD63) staining of IFN-γ–stimulated eosinophils (time = 10 minutes): MBP immunostaining (F), CD63 immunostaining (G), and combined image (H). (I-K) Double immunofluorescence (MBP and CD63) staining of C5a/CB-stimulated eosinophils (time = 10 minutes): MBP immunostaining (I), CD63 immunostaining (J), and combined image (K). (L) Combined image of isotype control for CD63 and MBP immunostaining. (M-O) Double immunofluorescence (MBP and CD63) staining of IL-3/IL-5/GM-CSF–stimulated eosinophils (time = 10 minutes): MBP immunostaining (M), CD63 immunostaining (N), and combined image (O). (P) Combined image of double immunofluorescence (MBP and CD63) staining of IFN-γ–stimulated eosinophils preincubated with genistein (10 −6 M), which inhibited the IFN-γ–induced translocation of CD63. (Q-T) Double immunofluorescence (RANTES and CD63) staining of IFN-γ–stimulated eosinophils: RANTES immunostaining (Q), CD63 immunostaining (R), combined image (S), and DIC image of the same cell (T). Original magnification is × 630 for all images.

To determine the intracellular localization site of CD63 relative to MBP (marker for the eosinophil granule crystalline core) and RANTES (marker for the crystalloid granule matrix region), we carried out a double immunofluorescent staining procedure on a population of isolated granules as well as freshly purified eosinophils. While immunoreactivity against MBP predominantly localized to the core region (Figure 1C-D) and did not colocalize with CD63, the immunoreactivity against RANTES and CD63 showed relative colocalization to the peripheral compartment of the crystalloid granules highlighted by the yellow color in the merged image (Figure 1E).

Mobilization of CD63 in stimulated eosinophils

To examine the intracellular localization and kinetics of CD63 mobilization relative to MBP in agonist-stimulated cells, freshly isolated eosinophils were stimulated (10 minutes) with either of IFN-γ (20 ng/mL), C5a (800 nM)/CB (10 ng/mL), or a cocktail of IL-3 (10 ng/mL)/IL-5 (5 ng/mL) and GM-CSF (10 ng/mL). Cytospins of stimulated eosinophils were prepared, double-immunostained for CD63 and MBP, and examined using confocal fluorescent microscopy. As early as 10 minutes after IFN-γ (Figure 1F-H) or C5a/CB stimulation (Figure 1I-K), CD63 immunostaining confined to the regions adjacent to the cell membrane, while MBP immunoreactivity except for some intensification at the cell periphery remained relatively unaltered. In contrast to IFN-γ and C5a/CB, stimulation with IL-3/IL-5/GM-CSF induced the appearance of discrete clusters of CD63 that colocalized predominantly with eosinophil MBP (Figure 1M-O). Interestingly, none of these cytokines on their own at the same doses affected the CD63 localization. Translocation of CD63 during stimulation by IFN-γ, C5a/CB, or IL-3/IL-5/GM-CSF was inhibited by the tyrosine kinase inhibitor, genistein (10 −6 M) (Figure 1P) (n = 5).

Agonist-induced cotranslocation of CD63 and RANTES

We have previously shown that IFN-γ stimulation of eosinophils induces the rapid mobilization of RANTES to the cell periphery prior to its release to extracellular space as an in vitro example of PMD.11 To examine the association of CD63 and RANTES translocation to cell periphery and selective release, double immunofluorescent staining with specific antibodies to RANTES and CD63 was conducted on IFN-γ–stimulated eosinophils. Following IFN-γ stimulation (10 minutes) of eosinophils, immunoreactivity against RANTES colocalized with that of CD63, with both signals translocating to the periphery of the cells (Figure 1Q-S). The continued presence of CD63 − and RANTES − crystalloid granules in the cytoplasm of IFN-γ–stimulated eosinophils was further evident by differential interference contrast (DIC) imaging (Figure 1T). Mouse IgG1 at equivalent concentrations was used instead of anti-CD63 and anti-RANTES as isotype control (Figure 1L). In double immunostaining procedures, appropriate isotype controls were run concurrently (combination of anti-CD63/BODIPY-FL and mouse IgG1/TRITC or a combination of mouse IgG1/BODIPY-FL and anti-MBP/TRITC) nonspecific binding was not observed (Figure2M-P).

The effects of dexamethasone on agonist-induced CD63 translocation.

Representative images of human eosinophils single-stained with BODIPY-FL–conjugated secondary antibody (green) to detect immunoreactivity against CD63. (A,B) Immunofluorescence (CD63) staining of IFN-γ–stimulated eosinophils and DIC image of the same cell (time = 10 minutes). (C,D) Immunofluorescence staining of eosinophils preincubated with dexamethasone (10 −6 M) prior to IFN-γ stimulation the DIC image of the same cell. (E,F) Immunofluorescence staining of C5a/CB-stimulated eosinophils DIC image of the same cell. (G,H) Immunofluorescence staining of eosinophils preincubated with dexamethasone (10 −6 M) prior to C5a/CB stimulation the DIC image of the same cell. (I,J) Immunofluorescence staining of IL-3/IL-5/GM-CSF–stimulated eosinophils DIC image of the same cell. (K,L) Immunofluorescence staining of eosinophils preincubated with dexamethasone (10 −6 M) prior to IL-3/IL-5/GM-CSF stimulation the DIC image of the same cell. (M,P) Combined images of immunofluorescence staining of eosinophils with a combination of anti-CD63/BODIPY-FL and mouse IgG1/TRITC the DIC image of the same cell (M,N). A combination of mouse IgG1/BODIPY-FL and anti-MBP/TRITC the DIC image of the same cell (O,P). Original magnification is × 630 for all images.

The effects of dexamethasone on agonist-induced CD63 translocation.

Representative images of human eosinophils single-stained with BODIPY-FL–conjugated secondary antibody (green) to detect immunoreactivity against CD63. (A,B) Immunofluorescence (CD63) staining of IFN-γ–stimulated eosinophils and DIC image of the same cell (time = 10 minutes). (C,D) Immunofluorescence staining of eosinophils preincubated with dexamethasone (10 −6 M) prior to IFN-γ stimulation the DIC image of the same cell. (E,F) Immunofluorescence staining of C5a/CB-stimulated eosinophils DIC image of the same cell. (G,H) Immunofluorescence staining of eosinophils preincubated with dexamethasone (10 −6 M) prior to C5a/CB stimulation the DIC image of the same cell. (I,J) Immunofluorescence staining of IL-3/IL-5/GM-CSF–stimulated eosinophils DIC image of the same cell. (K,L) Immunofluorescence staining of eosinophils preincubated with dexamethasone (10 −6 M) prior to IL-3/IL-5/GM-CSF stimulation the DIC image of the same cell. (M,P) Combined images of immunofluorescence staining of eosinophils with a combination of anti-CD63/BODIPY-FL and mouse IgG1/TRITC the DIC image of the same cell (M,N). A combination of mouse IgG1/BODIPY-FL and anti-MBP/TRITC the DIC image of the same cell (O,P). Original magnification is × 630 for all images.

Dexamethasone's effect on agonist-induced CD63 translocation

To examine the effect of dexamethasone on agonist-induced intracellular translocation of CD63, freshly purified eosinophils were incubated in the presence of dexamethasone 10 −6 for 60 minutes prior to agonist stimulation. Interestingly, dexamethasone inhibited the IFN-γ– (Figure 2A-D), C5a/CB– (Figure 2E-H), or IL-3/IL-5/GM-CSF– (Figure 2I-L) induced intracellular mobilization of CD63 (n = 6).

CD63 surface expression in resting and stimulated eosinophils

The surface expression of CD63 in freshly isolated eosinophils was examined by flow cytometry. Our results indicated that CD63 is expressed on the surface of resting eosinophils. Saponin-permeabilized cells showed a significant shift (50-fold) in mean fluorescent index (MFI), indicating a larger intracellular pool of CD63 (Figure 3) (n = 4). Total CD63 expression was similar in resting and agonist-stimulated cells, yet CD63 surface expression was enhanced after agonist stimulation (10 minutes), with C5a/CB inducing maximum up-regulation in contrast to the combination of IL-3/IL-5/GM-CSF, which induced a smaller degree of increased surface expression (Figure 4) (n = 4). The surface up-regulation of CD63 coincided with intracellular translocation of CD63 and RANTES upon agonist stimulation.

Analysis of CD63 surface expression.

CD63 expression on the surface of purified peripheral blood eosinophils was examined using flow cytometry analysis. (A) Isotype control for nonpermeabilized cells, (B) isotype control for (0.1%) saponin-permeabilized cells, (C) CD63 expression in nonpermeabilized eosinophils, and (D) CD63 expression in (0.1%) saponin-permeabilized cells.

Analysis of CD63 surface expression.

CD63 expression on the surface of purified peripheral blood eosinophils was examined using flow cytometry analysis. (A) Isotype control for nonpermeabilized cells, (B) isotype control for (0.1%) saponin-permeabilized cells, (C) CD63 expression in nonpermeabilized eosinophils, and (D) CD63 expression in (0.1%) saponin-permeabilized cells.

Analysis of CD63 surface expression in agonist-stimulated eosinophils.

CD63 surface expression in agonist-stimulated purified peripheral blood eosinophils was examined using flow cytometry analysis. (A) CD63 surface expression on resting eosinophils, (B) CD63 surface expression on IFN-γ–stimulated eosinophils, (C) CD63 surface expression on C5a/CB-stimulated eosinophils, and (D) CD63 surface expression on IL-3/IL-5/GM-CSF–stimulated eosinophils.

Analysis of CD63 surface expression in agonist-stimulated eosinophils.

CD63 surface expression in agonist-stimulated purified peripheral blood eosinophils was examined using flow cytometry analysis. (A) CD63 surface expression on resting eosinophils, (B) CD63 surface expression on IFN-γ–stimulated eosinophils, (C) CD63 surface expression on C5a/CB-stimulated eosinophils, and (D) CD63 surface expression on IL-3/IL-5/GM-CSF–stimulated eosinophils.

CD63 expression on enriched populations of crystalloid granules

To understand the pattern of membrane fusion and enhanced CD63 expression on the eosinophil surface membrane, we studied the expression of CD63 on the surface of isolated crystalloid granules. We immunostained both a permeabilized and a nonpermeabilized population of dispersed and highly purified eosinophil crystalloid granules. The results indicate that CD63 was expressed on the surface of crystalloid granules. Interestingly, the MFI of permeabilized granules was increased approximately 2-fold in saponin-permeabilized granules, while the MFI for the isotype controls of permeabilized and nonpermeabilized populations of granules was the same (Figure5) (n = 7). To ensure that granules were intact after isolation, granule preparations were immunostained with antibodies against MBP or RANTES, and no immunostaining was detected by flow cytometry against either of the 2 mediators in nonpermeabilized granule preparation. Only the permeabilized granules exhibited MBP and RANTES immunoreactivity (data not shown).

Analysis of CD63 expression on the surface of purified crystalloid granules.

Highly purified crystalloid granules were immunostained and analyzed using flow cytometry technique. (A) Isotype control, (B) isotype control for saponin-permeabilized granules, (C) CD63 expression on the surface of nonpermeabilized crystalloid granules, and (D) CD63 expression in saponin-permeabilized granules. The MFI of permeabilized crystalloid granules was approximately 2-fold increased when compared with nonpermeabilized granules.

Analysis of CD63 expression on the surface of purified crystalloid granules.

Highly purified crystalloid granules were immunostained and analyzed using flow cytometry technique. (A) Isotype control, (B) isotype control for saponin-permeabilized granules, (C) CD63 expression on the surface of nonpermeabilized crystalloid granules, and (D) CD63 expression in saponin-permeabilized granules. The MFI of permeabilized crystalloid granules was approximately 2-fold increased when compared with nonpermeabilized granules.

The association of CD63 translocation and enhanced surface expression with mediator release

We examined the association between intracellular translocation and surface up-regulation of CD63 with mediator release upon agonist stimulation. We measured β-hex release in the supernatant of eosinophils stimulated with IFN-γ, C5a/CB, or IL-3/IL-5/GM-CSF (10 minutes). Our results indicate that agonist stimulation of eosinophils (10 minutes) induced β-hex release. C5a/CB induced maximum release in contrast to the combination of IL-3/IL-5/GM-CSF, which induced minimum release (n = 6). Release of β-hex occurred concurrently with CD63 translocation to the cell periphery and the cell surface. Indeed, β-hex release triggered by various stimuli was associated with agonist-induced enhancement of CD63 surface expression measured by flow cytometry (Figures 6A and 4). In particular, C5a/CB induced more β-hex release in parallel with its stronger effect on CD63 surface expression (Figures 6A and 4). We also measured RANTES and EPO in the supernatant of IFN-γ–stimulated eosinophils. Our data indicate that IFN-γ stimulation of eosinophils (10 minutes) also induced the release of RANTES and EPO in a dose-dependant fashion (Figures 6B and 6C, respectively). We examined the effect of other agonists on CD63 translocation and surface membrane up-regulation and tested tumor necrosis factor (10 ng/mL), phorbol myristate acetate (10 ng/mL), and each of IL-3 (10 ng/mL), IL-5 (5 ng/mL), and GM-CSF (10 ng/mL) alone. The following combinations were also tested: IL-3 and IL-5, IL-3 and GM-CSF, and IL-5 and GM-CSF. Interestingly, none of the individual or combinations of agonists listed induced CD63 translocation, surface membrane up-regulation, and mediator release (data not shown).

Mediator (β-hex) release in agonist-stimulated eosinophils and effects of dexamethasone.

(A) Freshly purified eosinophils (2 × 10 5 cells) were stimulated using IFN-γ, C5a/CB, and IL-3/IL-5/GM-CSF for 10 minutes, and β-hex was measured in cell-free supernatants. The effect of dexamethasone on agonist-induced mediator release was examined by preincubating cells with dexamethasone (10 −6 ) for 60 minutes. A similar trend of release was observed in 6 separate donors. The first column shows spontaneous release of β-hex from eosinophils, the second and third columns show IFN-γ–induced release and dexamethasone effect, the fourth and fifth columns represent the C5a/CB-induced release and dexamethasone effect, and the sixth and seventh columns show the IL-3/IL-5/GM-CSF–induced release and dexamethasone effect. (B) Freshly purified eosinophils (2 × 10 6 cells) were stimulated using a different concentration of IFN-γ for 10 minutes, and RANTES was measured in cell-free supernatants. A similar trend of release was observed in 4 separate donors. (C) Freshly purified eosinophils (2 × 10 6 cells) were stimulated using a different concentration of IFN-γ for 10 minutes, and EPO was measured in cell-free supernatants. A similar trend of release was observed in 4 separate donors. The Student t test was used to analyze the results. In all experiments, given values represent averages of triplicate measurements. *The statistical significance of dexamethasone inhibition of mediator release error bars represent the mean and SEM of measurements (*P < .01).

Mediator (β-hex) release in agonist-stimulated eosinophils and effects of dexamethasone.

(A) Freshly purified eosinophils (2 × 10 5 cells) were stimulated using IFN-γ, C5a/CB, and IL-3/IL-5/GM-CSF for 10 minutes, and β-hex was measured in cell-free supernatants. The effect of dexamethasone on agonist-induced mediator release was examined by preincubating cells with dexamethasone (10 −6 ) for 60 minutes. A similar trend of release was observed in 6 separate donors. The first column shows spontaneous release of β-hex from eosinophils, the second and third columns show IFN-γ–induced release and dexamethasone effect, the fourth and fifth columns represent the C5a/CB-induced release and dexamethasone effect, and the sixth and seventh columns show the IL-3/IL-5/GM-CSF–induced release and dexamethasone effect. (B) Freshly purified eosinophils (2 × 10 6 cells) were stimulated using a different concentration of IFN-γ for 10 minutes, and RANTES was measured in cell-free supernatants. A similar trend of release was observed in 4 separate donors. (C) Freshly purified eosinophils (2 × 10 6 cells) were stimulated using a different concentration of IFN-γ for 10 minutes, and EPO was measured in cell-free supernatants. A similar trend of release was observed in 4 separate donors. The Student t test was used to analyze the results. In all experiments, given values represent averages of triplicate measurements. *The statistical significance of dexamethasone inhibition of mediator release error bars represent the mean and SEM of measurements (*P < .01).

The effect of glucocorticoids and tyrosine kinase inhibitor, genistein, on CD63 surface membrane up-regulation and mediator release

The clinical efficacy of glucocorticoids in allergic inflammation is well documented. It is thought that steroids may partially mediate inhibition of the elaboration of proinflammatory and eosinophil-active cytokines.32 We therefore examined the potential inhibitory effects of glucocorticoids on β-hex, EPO, and RANTES release and correlated this with CD63 translocation and surface membrane up-regulation. Treatment of eosinophils with dexamethasone (60 minutes) prior to agonist activation down-regulated β-hex release significantly (Figure 6A) and also inhibited agonist-induced CD63 membrane up-regulation (data not shown). Dexamethasone, in the absence of agonist stimulation, did not alter the β-hex spontaneous release (Figure 6A). In addition, dexamethasone inhibited the IFN-γ–induced EPO and RANTES release. Dexamethasone had no effect on eosinophil survival determined by trypan blue exclusion test.

To examine the potential involvement of tyrosine kinase activity in CD63 translocation and cell surface up-regulation following agonist stimulation, eosinophils were preincubated with genistein, a broad-spectrum inhibitor of tyrosine kinases (n = 4). Genistein pretreatment of eosinophils down-regulated the IFN-γ–induced β-hex release (33%) and also inhibited agonist-induced CD63 translocation (Figure 1P) and membrane up-regulation (data not shown).


5 CONCLUSIONS

Here, we demonstrate that the longitudinal perspective facilitated by the interrogation of electronic healthcare records provides an opportunity to stratify patients beyond the binary classification of eosinophilia. This additional phenotypic perspective allows appreciation of the multifactorial contributions to severe eosinophilic asthma as well as the identification of a small but distinct non-eosinophilic phenotype. Future studies should prioritize longitudinal perspectives on asthma characterization, as these are likely to better guide stratified patient management.


Since graduating from college five years ago, Ned Turner has

Since graduating from college five years ago, Ned Turner has worked for a national chain of men's clothing stores. Ned has held several positions with the company and is currently manager of a local branch store.

Over the past three years, Ned has observed a pattern in men who purchase suits. He believes that the majority of men's suit purchases are black, brown, blue, gray, and olive. He also notices that French cuff shirts are quite fashionable, but few stores carry a wide color selection. Since he has always wanted to be in business for himself, Ned's idea is to open a shop that sells suits that are black, brown, blue, gray, and olive and to carry a wide array of colors of French cuff shirts. The store will also sell fashionable ties and cuff links. Ned already has a name for his store, The Three B's and Go Suit Shop. Ned has discussed his plan with a number of people in the industry and they believe his idea is a viable one.

A new upscale shopping mall is opening nearby and Ned has decided that now is the time to take the plunge and go into business for him. Ned plans to open the Three B's and Go Suit Shop in the new mall.

One of the things Ned must decide in the process of transforming his idea to reality is the form of ownership for his new business. Should it be organized as a sole proprietorship, a partnership, or a corporation?

What advice would you give Ned? What advantages and disadvantages are there to each choice? The following diagram will help you organize your thoughts.


Allergic Asthma: Symptoms and Treatment


Ashley A. Sullivan, MSN FNP
Student, Samuel Merritt University, Oakland, Ca
RN, California Pacific Medical Center


Natalya M. Kushnir, MD
Director, Allergy and immunology Clinic of East Bay
Berkeley, CA

Original authors:

H. Henry Li, MD, PhD
FAAAAI, FACAAI
Institute for Asthma and Allergy
Wheaton and Chevy Chase Maryland

Michael A. Kaliner, MD FAAAAI
Medical Director, Institute for Asthma and Allergy
Chevy Chase and Wheaton, Maryland
Professor of Medicine, George Washington University School of Medicine
Washington DC

Definition and demographics

Asthma is truly a syndrome encompassing several disease entities/endotypes. The word asthma derives from the Greek word for panting, or breathlessness, and thus describes the primary symptom of this disease. Asthma is recognized as a complex condition with differences in severity, natural history, comorbidities, and treatment response. It has been defined as "a chronic inflammatory disorder associated with variable airflow obstruction and bronchial hyperresponsiveness. It presents with recurrent episodes of wheeze, cough, shortness of breath, chest tightness."

While the critical role of inflammation has been further substantiated, there is an evidence for considerable variability in the pattern of inflammation indicating phenotypic differences that may influence treatment responses. Gene-by-environmental interactions are important to the development and expression of asthma. Of the environmental factors, allergic reactions and pollution are of critical importance with expanding role for viral respiratory infections in these processes. The onset of asthma for most patients begins early in life with the pattern of disease persistence determined by early, recognizable risk factors including atopic disease, recurrent wheezing, and a parental history of asthma. Current asthma treatment with anti-inflammatory does not appear to prevent progression of the underlying disease severity.

Asthma is the most common chronic respiratory disorders, affecting all age groups, worldwide. The most recent comprehensive analyses of the Global Burden of Disease Study (GBD) undertaken in 2008-2010 estimates the number of people with asthma in the world as high as 334 million. A lower figure of 235 million used in the Global Asthma Report 2011 came from the most up to date GBD information available at that time based on analyses from 2000-2002. Prevalence of childhood asthma varies widely between countries, and between centers within countries, and estimated at 14%. Prevalence of recent wheeze in adolescents varied widely. The highest prevalence (>20%) was generally observed in Latin America and in English-speaking countries of Australasia, Europe and North America as well as South Africa. The lowest prevalence (<5%) was observed in the Indian subcontinent, Asia-Pacific, Eastern Mediterranean, and Northern and Eastern Europe. In Africa, 10-20% prevalence was mostly observed. Overall, 4.3% of respondents to the World Health Survey aged 18-45 in 2002-2003 reported a doctor&rsquos diagnosis of asthma, 4.5% had reported either a doctor&rsquos diagnosis or that they were taking treatment for asthma, and 8.6% reported that they had experienced attacks of wheezing or whistling breath (symptoms of asthma) in the preceding 12 months.

Prevalence of asthma in middle-aged and older American adults is found to be higher in women ( 9.7%) and higher among adults who are poor (10.6%). There is greater difficulty of distinguishing asthma from other respiratory conditions, such as chronic obstructive pulmonary disease (COPD) in older age groups. Geriatric asthma can be complicated by comorbidities, potential loss of reversibility of airway obstruction, as well as impairment in the perception of breathlessness. Limited data remains in clinical trials on geriatric asthma as asthma medications are rarely tested on the elderly. Due to asthma being commonly thought of as a childhood disease, the elderly are often under-diagnosed and undertreated.

Clinical Classification

It is increasingly clear that asthma syndrome is divided into distinct disease entities with specific mechanisms. The attempt for a new classification is made were "endotype" is proposed to be a subtype of a condition defined by a distinct pathophysiological mechanism. Criteria for defining asthma endotypes on the basis of their phenotypes and putative pathophysiology are suggested.

Currently asthma is classified into atopic and non-atopic types based on the onset of symptoms. Atopic refers to early-onset whereas non-atopic refers to late-onset. Despite the differentiation, a significant degree of overlap exists between the two types. The severity of symptoms is further classified based on the GINA severity grades into mild intermittent, mild persistent, moderate persistent and severe persistent asthma. Furthermore, asthma severity classification is different for various ages.

Signs and Symptoms of Asthma

To establish a diagnosis of asthma, the clinician should determine that:

  • Episodic symptoms of airflow obstruction or airway hyperresponsiveness are present.
  • Airflow obstruction is at least partially reversible.
  • Alternative diagnoses are excluded.

Recommended methods to establish the diagnosis are:

  • Detailed medical history.
  • Physical exam focusing on the upper respiratory tract, chest, and skin.
  • Spirometry to demonstrate obstruction and assess reversibility, including in children 5 years of age or older. Reversibility is determined either by an increase in FEV1 of &ge12 percent from baseline or by an increase &ge10 percent of predicted FEV1 after inhalation of a short-acting bronchodilator.

Additional studies are not routinely necessary but may be useful when considering alternative diagnoses:

  • Additional pulmonary function studies (e.g., measurement of lung volumes and evaluation of inspiratory loops) may be indicated, especially if there are questions about possible coexisting COPD, a restrictive defect, VCD, or possible central airway obstruction. A diffusing capacity test is helpful in differentiating between asthma and emphysema in patients, such as smokers and older patients, who are at risk for both illnesses.
  • Bronchoprovocation with methacholine, histamine, cold air, or exercise challenge may be useful when asthma is suspected, and spirometry is normal or near normal. For safety
  • reasons, bronchoprovocation testing should be carried out by a trained individual in an
  • Appropriate facility and is not generally recommended if the FEV1 is <65 percent predicted. A positive methacholine bronchoprovocation test is diagnostic for the presence of airway hyperresponsiveness, a characteristic feature of asthma that also can be present in other conditions (e.g., allergic rhinitis, cystic fibrosis, COPD, among others). Thus, although a positive test is consistent with asthma, a negative bronchoprovocation may be more helpful to rule out asthma.
  • Chest x ray may be needed to exclude other diagnoses.
  • Allergy testing
  • Biomarkers of inflammation. The usefulness of measurements of biomarkers of inflammation (e.g., total and differential cell count and mediator assays) in sputum, blood, urine, and exhaled air as aids to the diagnosis and assessment of asthma

It is important to consider a diagnosis of asthma if certain elements of the clinical history are present &ndash they are not diagnostic by themselves but increase the probability of a diagnosis of asthma:

  1. Wheezing&mdashhigh-pitched whistling sounds when breathing out&mdashespecially in children. (Lack of wheezing and a normal chest examination do not exclude asthma.)
  2. History of any of the following:
    1. Cough, worse particularly at night
    2. Recurrent wheeze
    3. Recurrent difficulty in breathing
    4. Recurrent chest tightness
    1. Exercise
    2. Viral infection
    3. Animals with fur or hair
    4. House-dust mites (in mattresses, pillows, upholstered furniture, carpets)
    5. Mold
    6. Smoke (tobacco, wood)
    7. Pollen
    8. Changes in weather
    9. Strong emotional expression (laughing or crying hard)
    10. Airborne chemicals or dusts
    11. Menstrual cycles

    Spirometry is needed to establish a diagnosis of asthma.

    Physical examination should be focused on upper respiratory tract, chest, and skin. Certain findings present on physical exam increase the probability of asthma, while their absence does not rule it out, because the disease is by definition variable, and signs of airflow obstruction are often absent between attacks:

    1. Hyper expansion of the thorax, especially in children use of accessory muscles appearance of hunched shoulders and chest deformity.
    2. Sounds of wheezing during normal breathing, or a prolonged phase of forced exhalation (typical of airflow obstruction). Wheezing may only be heard during forced exhalation, but it is not a reliable indicator of airflow limitation.
    3. Increased nasal secretion, mucosal swelling, and/or nasal polyps.
    4. Atopic dermatitis/eczema or any other manifestation of an allergic skin condition.

    The presence of concomitant diseases or conditions that may influence asthma, including:

    1. Rhinosinusitis,
    2. Gastro-esophageal reflux or laryngopharyngeal reflux, and
    3. Bronchitis or smoking.

    Early in the disease, symptoms may include a vague, heavy feeling of tightness in the chest and in the allergic patient, there may be associated rhinitis and conjunctivitis symptoms. Typical symptoms which patients experience include coughing, wheezing, chest tightness and dyspnea. Cough in asthma is usually non-productive, but it may progress to expectoration of viscous, mucoid sputum which is difficult to clear. If the sputum turns purulent or discolored, an infection may be present, as the sputum in asthma is usually clear to light yellow in color.

    There is a subgroup of asthmatics whose asthma is characterized solely by cough, without overt wheezing, the "cough variant of asthma". Monitoring of PEF or methacholine inhalation challenge, to clarify whether there is bronchial hyperresponsiveness consistent with asthma, may be helpful in diagnosis. The diagnosis of cough variant asthma is confirmed by a positive response to asthma medication.

    In the completely asymptomatic patient, results of chest examination will be normal, although head, eye, ear, nose, and throat examination may disclose concomitant serous otitis media, allergic conjunctivitis, allergic rhinitis, nasal polyps, paranasal sinus tenderness, signs of postnasal drip, or pharyngeal mucosal lymphoid hyperplasia. Clubbing of the fingers is extremely rare in uncomplicated asthma, and this finding should direct the physician's attention toward diseases such as bronchiectasis, cystic fibrosis, pulmonary neoplasm, or cardiac disease. Many symptomatic asthmatics can be diagnosed by careful auscultation of the chest which reveals the presence of expiratory wheezing and a somewhat prolonged expiratory phase.

    Exacerbations of asthma are acute or subacute episodes of progressively worsening shortness of breath, cough, wheezing, and chest tightness&mdashor some combination of these symptoms. Exacerbations are characterized by decreases in expiratory airflow that can be documented and quantified by simple measurement of lung function (spirometry or PEF), can vary widely among individuals and within individuals from rare to frequent. It is important to understand that the severity of disease does not necessarily correlate with the intensity of exacerbations, which can vary from mild to very severe and life-threatening.

    Patients at any level of severity, even intermittent asthma, can have severe exacerbations. For example, a person who has intermittent asthma can have a severe exacerbation during a viral illness or when exposed to allergens to which he or she is sensitized or to noxious fumes and irritants. In fact, the last classification &ldquomild intermittent asthma&rdquo was changed to &ldquointermittent asthma&rdquo, emphasizing that patients at any level of severity &mdash including intermittent &mdash can have severe exacerbations. The frequency of exacerbations requiring intervention with oral systemic corticosteroids now changed to classification of persistent, rather than intermittent asthma. However, severity can determine prolongation of the illness and is often characterized by unremitting symptoms with poor response to therapy. The duration of acute exacerbations may vary from a few hours to a few days. These unpredictable variations in exacerbations can present treatment dilemmas in clinical practice.

    Assessment of severity requires assessing the following components of current impairment:

    1. Symptoms
      1. Nighttime awakenings
      2. Need for SABA for quick relief of symptoms
      3. Work/school days missed
      4. Ability to engage in normal daily activities or in desired activities
      5. Quality-of-life assessments

      Assessment of Risk

      Assessment of the risk of future adverse events requires careful medical history, observation, and clinician judgment. Documentation of warning signs and adverse events will be necessary when a patient is felt to be at increased risk. Patients who are deemed at increased risk of adverse outcomes need close monitoring and frequent assessment by their clinicians.

      Predictors that have been reported to be associated with increased risk of exacerbations or death include:

      • Severe airflow obstruction, as detected by spirometry
      • Persistent severe airflow obstruction. Two or more ED visits or hospitalizations for asthma in the past year any history of intubation or ICU admission, especially if in the past 5 years
      • Patients report that they feel in danger or frightened by their asthma
      • Certain demographic or patient characteristics: female, nonwhite, nonuse of ICS therapy, and current smoking
      • Psychosocial factors: depression, increased stress, socioeconomic factors
      • Attitudes and beliefs about taking medications

      Asthma in elderly

      Asthma affecting individuals across the lifespan. Current evidence consistently suggests that asthma is common among elderly subjects. Because of increased longevity, the proportion of individuals aged 65 years and older is increasing worldwide. By 2030, elderly subjects will comprise

      36% of the populations of the United States (U.S.) and China, respectively. Determining the exact prevalence of asthma in elderly is made difficult by under-diagnosis due to decreased perception or under-reporting of symptoms by patients, suboptimal utilization of spirometry, misclassification of asthma as chronic obstructive pulmonary disease (COPD), and failure to recognize asthma in subjects with co-morbidities such as congestive heart failure or COPD. In two nationwide surveys in the U.S. estimates of the prevalence of current asthma in the elderly were 5.9% for the period 1980&ndash2004. In elderly subjects, asthma is more common in women than in men. Compared to children or younger adults, older adults and/or elderly subjects have greater morbidity and healthcare costs from asthma, thus it is important to recognize and treat asthma in older population.

      Causes of Asthma

      The allergic asthma phenotype dominates in early life. Although asthma has a strong genetic component, environmental factors must occur for it to manifest. The paradigm for allergen induction of asthma is from allergen exposure &rarr allergic sensitization &rarr asthma development. While a variety of ambient and indoor allergic exposures have been implicated in the development and exacerbation of childhood asthma, the indoor environment has greatest influence on asthma development. Children sensitized to aeroallergens at a young age are likely to have persistent asthma symptoms into late childhood and adulthood and show poorer lung function than those not sensitized. House dust mite (HDM), furred pets, cockroach, rodent and mold, with regional variation, account for the large proportion of aeroallergens associated with sensitization and asthma. In many cases, exposure and sensitivity follow a. Evidence supporting dose-response relationship is particularly strong for dust mite and cat.

      The steady increase in population trends towards urban centers also shares the trajectory of increasing air pollution. Indoor and ambient air pollution have been associated with a variety of adverse cardiopulmonary health effects including asthma symptoms, exacerbations and decline in lung function. The pollutants best studied are the gases nitrogen dioxide (NO2), ozone (O3), volatile organic compounds (VOCs), and particulate matter (PM) that comprises soot.

      Recent evidence has demonstrated elevated pollution exposure in utero and in the first year of life may influence the development of asthma in young children. Exposure to indoor pollution of PM2.5 and VOCs is directly correlated with asthma inflammatory markers in schoolchildren with and without asthma, indicating potential induction of allergic airway inflammation with these exposures.

      Environmental tobacco smoke (ETS) is an independent determinant of the development of asthma. Tobacco smoke contains many VOCs and NO2, which are likely to serve as the conduits to poor respiratory outcomes. In vivo studies also suggest that exposure to ETS is associated with IL-13 and greater serum IgE in children with asthma compared to non-exposed asthmatic children and controls, suggesting an augmentation of the Th2 immunophenotype with exposure.

      Since the early 2000s the inverse relationship between farming, particularly traditional dairy farming lifestyle, and the development of asthma has been demonstrated early in life and appears to hold true well into adulthood. Children living on farms also had reduced rates of sensitization and other atopic conditions. Farm studies have implicated the rich diversity of microbial exposure both in the animal and home environments are strongly and inversely associated with asthma, implying that the early and persistent microbial environment influences the development of the immune system away from allergic and asthmatic predisposition.

      The intestinal microbiome likely influences the immune system in a manner similar to that related to farm exposure.

      Because limiting exposure to allergens and allergy immunotherapy are both specifically helpful in treating allergic asthmatic subjects, a careful search for possible allergies is indicated in nearly all asthmatics, certainly all persistent asthmatics.

      In addition to allergen-induced asthma, many other factors and conditions such as exercise, infection, occupational chemical exposures, side effects to medications such as beta adrenergic blocking agents, bronchitis, and Churg-Strauss allergic granulomatosis can also cause asthma. Sinusitis, GERD, hyperthyroidism, pregnancy and viral illnesses may complicate asthma.

      Pathogenesis and genetics

      Over the last decade research has confirmed the important role of inflammation in asthma, unfortunately specific processes related to the transmission of airway inflammation to specific pathophysiologic consequences of airway dysfunction and the clinical manifestations of asthma have yet to be fully understood. Similarly, much has been learned about the host &ndashenvironment factors that determine airways&rsquo susceptibility to these processes, but the relative contributions of either and the precise interactions between them that leads to the initiation or persistence of disease is difficult to establish. The concepts underlying asthma pathogenesis have evolved dramatically in the past 25 years and are still undergoing evaluation as various phenotypes of this disease are defined and greater insight links clinical features of asthma with genetic patterns.

      Because asthma involves an integrated response in the conducting airways of the lung to known or unknown triggers, it is a multicellular disease, involving abnormal responses of many different cell types in the lung.

      Environmental triggers concurrently act on airway afferent nerves (which both release their own peptide mediators and stimulate reflex release of the bronchoconstrictor acetylcholine) and airway epithelial cells to initiate responses in multiple cell types that contribute to the mucous metaplasia and airway smooth muscle bronchoconstriction that characterize asthma.

      Epithelial cells release TSLP and IL-33, which act on airway dendritic cells, and IL-25, which together with IL-33 acts on mast cells, basophils, and innate type 2 lymphocytes. These secreted products stimulate dendritic cell maturation that facilitates the generation of effector T cells and triggers the release of both direct bronchoconstrictors and Th2 cytokines from innate immune cells, which feedback on both the epithelium and airway smooth muscle and further facilitate amplification of airway inflammation through subsequent adaptive T cell responses.

      Asthma is genetically heterogeneous. A few common alleles are associated with disease risk at all ages. Implicated genes suggest a role for communication of epithelial damage to the adaptive immune system and activation of airway inflammation. Asthma runs strongly in families, and its heritability has been estimated as 60%. Genetic studies offer a structured means of understanding the causes of asthma as well as identifying targets that can be used to treat the syndrome. Recent genome-wide association studies begun to shed light on both common and distinct pathways that contribute to asthma and allergic diseases. Associations with variation in genes encoding the epithelial cell-derived cytokines, interleukin-33 (IL-33) and thymic stromal lymphopoietin (TSLP), and the IL1RL1 gene encoding the IL-33 receptor, ST2, highlight the central roles for innate immune response pathways that promote the activation and differentiation of T-helper 2 (Th2) cells in the pathogenesis of both asthma and allergic diseases. The factor of atopy, or the genetic tendency for development of the condition, remains the strongest predisposing factor for the development of asthma. These and other genetic findings expanding our understanding of the common and unique biological pathways that are dysregulated in these related conditions and eventually will be helpful in design of new therapies and prevention modalities.

      Prevention

      Multifactorial disease requires multiple approaches in order to minimize development or progression of the clinical symptoms.

      Most convincing evidence for early life environmental exposures influencing the development of asthma would be from randomized controlled interventions to specifically addressing the offending agent and demonstrate lower incidence of asthma development. Allergen remediation strategies directed at cat, dog, mold, mouse and cockroach demonstrate substantially decrease exposure levels in homes. Interventions to reduce HDM alone have been effective and seem to improve early outcomes.

      Recent meta-analyses have shown multifaceted allergen remediation programs to be protective against the development of asthma with 20-50% reduction in odds. The most protective effect was seen in children with greater than 5 years of follow-up, indicating a true decrease in risk to those prone to develop atopic asthma.

      The best preventative effect of allergen avoidance was the Canadian Childhood Asthma Primary Prevention Study in a high-risk birth cohort. In this study, the intervention was avoidance of house dust mite, pets, and environmental tobacco smoke starting prenatally, and encouragement of breastfeeding with delayed introduction of solids. HDM interventions included encasing parents&rsquo and infants&rsquo mattresses and box springs, weekly hot water wash of all bedding and application of benzyl benzoate to carpets and upholstery before birth and at 4 and 8 months of age. Children receiving the intervention had significantly less physician diagnoses of asthma, wheeze in the past 12 months and wheeze apart from colds when evaluated at age 7 years. Another birth cohort study also observed significantly fewer asthma symptoms at age 8 years old in a high-risk birth cohort intervention focused on HDM and food allergen avoidance in early life, and a significant decrease in atopy at the 8-year time point.

      Large studies assessing increased exposure to indoor fungi before the development of asthma symptoms suggests that Penicillium, Aspergillus, and Cladosporium species pose a respiratory health risk in susceptible populations. Increased exacerbation of current asthma symptoms in children and adults were associated with increased levels of Penicillium, Aspergillus, Cladosporium, and Alternaria species, although further work should consider the role of fungal diversity and increased exposure to other fungal species.

      Early studies on the effect of probiotics to affect asthma development by influencing the perinatal microbiome have been mixed. A recent study found significant decrease in the risk of atopic sensitization associated with pre and post-natal administration of probiotics, however there was no effect on asthma or wheeze.
      Vitamins are essential constituents of our diet that have long been known to influence the immune system. Vitamins A and D have received particular attention in recent years as these vitamins have been shown to have an unexpected and crucial effect on the immune response.

      In preterm infants without bronchopulmonary dysplasia, Palivizumab, a monoclonal antibody against RSV, reduces respiratory morbidity up to 78%. Recent findings in late preterm children without BPD suggests that prophylaxis through infancy may decrease recurrent wheeze in the first year of life by 10% and by up to 50% at three years of age. While encouraging, further longitudinal studies are necessary to evaluate the effect of palivizumab prophylaxis to decrease the incidence of asthma in childhood.
      Recent evidence suggests that anti-allergen immunotherapy to cross-link the FcέR1 receptor may diminish viral induced asthma symptoms. While alterations of the physical environment have been studied, little attention has been given to the approach of altering the immune constitution of high-risk individuals. In this respect, immunomodulators, such as Omalizumab may be of future interest.

      Treatment

      Treatment with anti-inflammatory drugs can, to a large extent, reverse some of these processes however, the successful response to therapy often requires weeks to achieve and, in some situations, may be incomplete.

      The goals of asthma treatment include improving quality of life for people who have asthma in addition to controlling symptoms, reducing the risk of exacerbations, and preventing asthma-related death.

      A recent large international trial demonstrated that significant reductions in the rate of severe exacerbations and improvements in quality of life were achieved by aiming at achieving guideline-defined asthma control and by adjusting therapy to achieve it. It is important, therefore, to examine how the disease expression and control are affecting the patient&rsquos quality of life. Specific clinical assessment questionnaires were generated to assist practicing physicians in asthma patient evaluation:

      Asthma-Specific Quality of Life

      • Mini Asthma Quality of Life Questionnaire (Juniper et al. 1999a)
      • Asthma Quality of Life Questionnaire (Katz et al. 1999 Marks et al. 1993)
      • ITG Asthma Short Form (Bayliss et al. 2000)
      • Asthma Quality of Life for Children (Juniper et al. 1996)

      The change in emphasis from previous practice guidelines is in periodic assessment of asthma control. For initiating treatment, asthma severity should be classified, and the initial treatment should correspond to the appropriate category of severity. Once treatment is established, the emphasis is on assessing asthma control to determine if the goals for therapy have been met and if adjustments in therapy (step up or step down) would be appropriate.

      Components considered essential to effective asthma management:

      Measures of assessment and monitoring, obtained by objective tests, physical examination, patient history and patient report, to diagnose and assess the characteristics and severity of asthma and to monitor whether asthma control is achieved and maintained

      • Education for a partnership in asthma care
      • Control of environmental factors and comorbid conditions that affect asthma

      Pharmacologic therapy

      The goals of therapy are to achieve asthma control by reducing impairment and risk:

      • Prevent chronic and troublesome symptoms (e.g., coughing or breathlessness in the daytime, in the night, or after exertion)
      • Require infrequent use (&le2 days a week) of inhaled SABA for quick relief of symptoms
      • Maintain (near) &ldquonormal&rdquo pulmonary function
      • Maintain normal activity levels (including exercise and other physical activity and attendance at work or school)
      • Meet patients&rsquo and families&rsquo expectations of and satisfaction with asthma care
      • Prevent recurrent exacerbations of asthma and minimize the need for ED visits or hospitalizations
      • Prevent progressive loss of lung function for children, prevent reduced lung growth
      • Provide optimal pharmacotherapy with minimal or no adverse effects

      Patients&rsquo detailed recall of symptoms decreases over time therefore, the clinician may choose to assess over a 2-week, 3-week, or 4-week recall period. Symptom assessment for periods longer than 4 weeks should reflect more global symptom assessment, such as inquiring whether the patient&rsquos asthma has been better or worse since the last visit and inquiring whether the patient has encountered any particular difficulties during specific seasons or events.

      Low FEV1 is associated with increased risk of severe asthma exacerbations. Regular monitoring of pulmonary function is particularly important for asthma patients who do not perceive their symptoms until airflow obstruction is severe. There is no readily available method of detecting the &ldquopoor perceivers.&rdquo The literature reports that patients who had a near-fatal asthma exacerbation, as well as older patients, are more likely to have poor perception of airflow obstruction.

      Long-term control medications

      Corticosteroids: Block late-phase reaction to allergen, reduce airway hyperresponsiveness, and inhibit inflammatory cell migration and activation. They are the most potent and effective anti-inflammatory medication currently available. ICSs are used in the long-term control of asthma. Short courses of oral systemic corticosteroids are often used to gain prompt control of the disease when initiating long-term therapy long-term oral systemic corticosteroid is used for severe persistent asthma.

      Cromolyn sodium and nedocromil: Stabilize mast cells and interfere with chloride channel function. They are used as alternative, but not preferred, medication for the treatment of mild persistent asthma. They can also be used as preventive treatment prior to exercise or unavoidable exposure to known allergens.

      Immunomodulators: Omalizumab (anti-IgE) is a monoclonal antibody that prevents binding of IgE to the high-affinity receptors on basophils and mast cells. Omalizumab is used as adjunctive therapy for patients &ge12 years of age who have allergies and severe persistent asthma. Clinicians who administer omalizumab should be prepared and equipped to identify and treat anaphylaxis that may occur.

      Leukotriene modifiers: (Montelukast, pranlukast, zafirlukast, and zileuton). Target a single group of inflammatory mediators by either blocking the leukotriene receptor or reducing the activity of enzymes required for leukotriene synthesis. Two LTRAs are available&mdashmontelukast (for patients >1 year of age) and zafirlukast (for patients &ge7 years of age). The 5-lipoxygenase pathway inhibitor zileuton is available for patients &ge12 years of age liver function monitoring is essential. LTRAs are alternative, but not preferred, therapy for the treatment of mild persistent asthma (Step 2 care). LTRAs can also be used as adjunctive therapy with ICSs, but for youths &ge12 years of age and adults. Zileuton can be used as alternative but not preferred adjunctive therapy in adults.

      LABAs: Salmeterol and formoterol after a single dose administration have at least 12 hours duration of bronchodilation. Because of their slower onset of action, the uses of LABA for the treatment of acute symptoms or exacerbations is not currently recommended or is monotherapy for long-term control of asthma.

      • LABAs are used in combination with ICSs for long-term control and prevention of symptoms in moderate or severe persistent asthma (step 3 care or higher in children &ge5 years of age and adults)
      • Of the adjunctive therapies available, LABA is the preferred therapy to combine with ICS in youths &ge12 years of age and adults
      • The beneficial effects of LABA in combination therapy for the great majority of patients who require more therapy than low-dose ICS alone to control asthma (i.e., require step 3 care or higher) should be weighed against the increased risk of severe exacerbations, although uncommon, associated with the daily use of LABAs (see discussion in text).

      For patients &ge5 years of age who have moderate persistent asthma or asthma inadequately controlled on low-dose ICS, the option to increase the ICS dose should be given equal weight to the option of adding LABA. For patients &ge5 years of age who have severe persistent asthma or asthma inadequately controlled on step 3 care, the combination of LABA and ICS is the preferred therapy.

      LABA may be used before exercise, but duration of action does not exceed 5 hours with chronic regular use. Frequent and chronic use of LABA for EIB is discouraged, because this use may disguise poorly controlled persistent asthma.

      Methylxanthines: Sustained-release theophylline is a mild to moderate bronchodilator used as alternative, not preferred, adjunctive therapy with ICS (Evidence A). Theophylline may have mild anti-inflammatory effects. Monitoring of serum theophylline concentration is essential.

      Quick-relief medications
      Anticholinergics: Inhibit muscarinic cholinergic receptors and reduce intrinsic vagal tone of the airway. Ipratropium bromide provides additive benefit to SABA in moderate-to-severe asthma exacerbations. May be used as an alternative bronchodilator for patients who do not tolerate SABA (Evidence D).

      SABAs: Albuterol, levalbuterol, and pirbuterol are bronchodilators that relax smooth muscle that have become constricted as a result of environmental stimuli. Therapy of choice for relief of acute symptoms and prevention of EIB. SABAs will provide rapid relief of symptoms, although do not target underlying inflammation associated with asthma.

      Systemic corticosteroids: Although not short acting, oral systemic corticosteroids are used for moderate and severe exacerbations as adjunct to SABAs to speed recovery and prevent recurrence of exacerbations.

      Other treatments

      Allergen Immunotherapy
      Allergen injection immunotherapy is effective in allergic asthma as well as in allergic rhinoconjunctivitis and has been shown to lead to highly significant improvements in symptoms, reduction in rescue medication, and improvements in both allergen specific and non-specific bronchial hyperresponsiveness. Immunotherapy is particularly effective in seasonal asthma, although less effective in perennial asthma. Bronchial asthma is a risk-factor for systemic reactions to immunotherapy and should not be considered in poorly controlled asthmatics. Allergy management is superimposed upon other treatment modalities for long-term control at all levels of asthma. Concurrent upper airway disease, eg, allergic rhinitis, sinusitis, should be treated, and the total dose of inhaled corticosteroids must be monitored.

      Biological treatment: Omalizumab (monoclonal anti-IgE antibody) may be considered as adjunctive therapy in step 5 or 6 care for patients who have allergies and severe persistent asthma that is inadequately controlled with the combination of high-dose ICS and LABA. Omalizumab is effective in reducing asthma exacerbations and hospitalizations in patients with increased levels of total IgE. It is recommended for use in moderate to severe asthma patients as an adjunctive therapy to inhaled steroids and during steroid tapering, in patients with steroid-resistant asthma, and in patients who need to reduce or withdraw their inhaled steroids.

      Bronchial thermoplasty (BT) is a novel therapy for patients with severe asthma. Using radio frequency thermal energy, it aims to reduce the airway smooth muscle mass. Several clinical trials have demonstrated improvements in asthma-related quality of life and a reduction in the number of exacerbations following treatment with BT. In addition, recent data has demonstrated the long-term safety of the procedure as well as sustained improvements in rates of asthma exacerbations, reduction in health care utilization, and improved quality of life.

      In the past 10 years, there have been substantial advances in the understanding of asthma genetics, airway biology, and immune cell signaling. These advances have led to the development of small molecule therapeutics and biologic agents that may improve asthma care in the future. Several new classes of asthma drugs&mdashincluding ultra-long acting &beta agonists and modulators of the interleukin 4 (IL-4), IL-5, IL-13, and IL-17 pathways&mdashhave been evaluated in randomized controlled trials. Other new drug classes&mdashincluding dissociated corticosteroids, CXC chemokine receptor 2 antagonists, toll-like receptor 9 agonists, and tyrosine kinase inhibitors&mdashremain in earlier phases of development.

      Other co-morbid conditions treatment

      In all patients, symptomatic therapies are also given, to be used on an as needed basis. The goal in all of these patients is to tailor the medicines and their doses to control the level of the disease, always trying for optimal control with the lowest effective dose of medications. At least half of US adults with asthma have at least 1 other chronic condition. Having asthma and other chronic conditions are associated with poorer asthma outcomes. Several studies considered the relationship between asthma and other specific chronic conditions results of these studies indicated that having depression or anxiety and/or panic disorder is associated with an increased risk of developing a new asthma diagnosis and with poorer asthma outcomes. In addition, results of these studies indicated that having asthma is associated with an increased risk of developing a new depression or anxiety and/or panic disorder diagnosis.

      Current NIH guidelines recommend that all patient who have had an asthma-related hospitalization should be evaluated by asthma specialist. In doing so, patients may likely improve quality of life and decrease asthma-related morbidity and mortality


      Watch the video: Binary 10: Excess notation (January 2022).