Information

Are restriction enzymes active at −20 °C?


I have digested my DNA with NotI enzyme and put it in the −20 °C freezer without heat inactivating it. Can restriction enzymes work at −20 °C? Should I expect STAR activity?


Enzymes have temperature optima based on the organism they were isolated from. So I would predict the there is virtually no activity at −20 °C. Another consideration is that the reactions are likely to be frozen solid, so that would limit diffusion, and also slow it down. But the real question is: what are you afraid of? Just the star activity? Even if there were star activity, would that adversely affect your experiments?


While there is unlikely to be any activity when the enzyme is frozen, there are better methods to prevent star activity.

1: If you are running the reaction in a PCR machine, you can program the machine prior to the digest to heat up to 65 degrees for 10 minutes after the intended digestion timeframe to heat inactivate NotI. Since NotI is a heat-labile enzyme, this prevents star activity by denaturing it.

2: You can use NotI-HF, which has been engineered by NEB to greatly reduce the amount of star activity and can therefore be left incubating at 37°C overnight.

3: You can gel purify or perform a "PCR purification" on your digested DNA samples, this also removes any protein present and therefore prevents star activity.


Abstract

It is thought that most of the type II restriction endonucleases interact with DNA as homodimers. Cfr10I is a typical type II restriction enzyme that recognises the 5′-Pu ↓ CCGGPy sequence and cleaves it as indicated by the arrow. Gel-filtration and analytical ultracentrifugation data presented here indicate that Cfr10I is a homotetramer in isolation. The only SfiI restriction enzyme that recognises the long interrupted recognition sequence 5′-GGCCNNNNNGGCC has been previously reported to operate as a tetramer however, its structure is unknown. Analysis of Cfr10I crystals revealed that a single molecule in the asymmetric unit is repeated by D2 symmetry to form a tetramer. To determine whether the packing of the Cfr10I in the crystal reflects the quaternary structure of the protein in solution, the tryptophan W220 residue located at the putative dimer-dimer interface was mutated to alanine, and the structural and functional consequences of the substitution were analysed. Equilibrium sedimentation experiments revealed that, in contrast to the wild-type Cfr10I, the W220A mutant exists in solution predominantly as a dimer. In addition, the tetramer seems to be a catalytically important form of Cfr10I, since the DNA cleavage activity of the W220A mutant is <0.1 % of that of the wild-type enzyme. Further, analysis of plasmid DNA cleavage suggests that the Cfr10I tetramer is able to interact with two copies of the recognition sequence, located on the same DNA molecule. Indeed, electron microscopy studies demonstrated that two distant recognition sites are brought together through the DNA looping induced by the simultaneous binding of the Cfr10I tetramer to both sites. These data are consistent with the tetramer being a functionally important form of Cfr10I.


Everything You Ever Wanted to Know About Type II Restriction Enzymes

What are Type II Restriction Enzymes used for?

Type II restriction enzymes are the familiar ones used for everyday molecular biology applications such as gene cloning and DNA fragmentation and analysis. These enzymes cleave DNA at fixed positions with respect to their recognition sequence, creating reproducible fragments and distinct gel electrophoresis patterns. Over 3,500 Type II enzymes have been discovered and characterized, recognizing some 350 different DNA sequences. Thousands more &lsquoputative&rsquo Type II enzymes have been identified by analysis of sequenced bacterial and archaeal genomes, but remain uncharacterized.

How are Type II Restriction Enzymes named?

Restriction enzymes are named according to the micro-organism in which they were discovered. The restriction enzyme &lsquoHindIII&rsquo, for example, is the third of several endonuclease activities found in the bacterium Haemophilus influenzae serotype d. The prefix &lsquoR.&rsquo is added sometimes to distinguish restriction enzymes from the modification enzymes with which they partner in vivo. Thus, &lsquoR.HindIII&rsquo refers specifically to the restriction enzyme, and &lsquoM.HindIII&rsquo to the modification enzyme. When there is no ambiguity, the prefix &lsquoR.&rsquo is omitted.

Type II Restriction Enzymes Properties

Type II restriction enzymes are very diverse in terms of amino acid sequence, size, domain organization, subunit composition, co-factor requirements and modes of action. They are loosely classified into a dozen or so sub-types according to their enzymatic behavior. This is a practical classification that reflects their properties rather than their phylogeny. It does not necessarily reflect evolutionary or structural relationships, and the subtypes are not mutually exclusive. An enzyme can belong to several subtypes if it exhibits each of their defining characteristics. We discuss these subtypes in their order of importance the four principal ones are Type IIP, IIS, IIC, and IIT.


Definition of Enzyme’s Active Site

The enzyme’s active site is the small region, which seems like a cleft or cavity composed of nearly 10-15 amino acid residues. According to the term, we can define it as a site that activates the complex enzyme to bind with the particular substrate, induces the substrate’s transition state and stabilize the product formation. Thus, the active site merely refers to as the catalytic site. The active site performs two functional activities.

  1. Binding Activity: The binding activity is a property of the enzyme’s active site, which increases the binding affinity of the substrate towards an enzyme.
  2. Catalytic activity: It is a property of an enzyme’s active site, which aids in the catabolic reaction of the enzyme and substrate to yield product by reducing the activation energy.

Reaction Mechanism of an Enzyme

In an enzyme-catalyzed reaction, the substrate will attach to the enzyme’s active site. A specific substrate will bind to the active site of an enzyme. As a result, an “Enzyme-substrate complex” forms. In the E-S complex, the substrate on enzyme activity will convert into a product. At last, the products get released, and the enzyme becomes free.

Example

Let us take an example, where sucrose is a substrate combining with the active site of an enzyme “Sucrase”. After, the binding of sucrose with an enzyme sucrase, an E-S complex forms. Then, a reaction between sucrase and sucrose takes place. The reaction will change the sucrose’s structural conformation called “Transition state of the Sucrose”. The change in sucrose’s structural configuration leads to the conversion of the E-S complex into the E-P complex. At last, glucose and fructose are released as products form the sucrase enzyme.

Key Points

  • An active site is a specific location found in the enzyme where a substrate binds to catalyze the reaction. It is also called “Enzyme catalytic surface”.
  • About 10-15 amino acid residues combine to form an active site.

  • The active site possesses a specific geometrical shape and chemical signals that allow the specific recognition and binding between an enzyme and a substrate.
  • An active site will allow the specific substrate to bind whose shape complements the shape of an active site. Therefore, a substrate is like is a key that can only fit into the particular lock, i.e. active site.
  • The active site of an enzyme catalyzes many chemical or biological pathways.
  • After the enzyme-substrate complex formation, both substrate and active site change its structural configuration by bending the target bonds and breaking the substrate molecule into a product.
  • Enzymes show catalytic activity, which is due to its active site. It catalyzes a substrate into a product after complementary binding of the substrate with the active site of an enzyme, depending upon the geometric shape, size, charge and stereospecificity etc.
  • The active site of an enzyme induces the “Transition of the substrate”.

Important Characteristics

Following are the important characteristics of an active site that includes:

Hydrophobicity

The initial binding of substrate and enzyme occur through the non-covalent bond. But, the catalytic site involves hydrophobic interaction in the attachment of a substrate with an enzyme. Hydrophobic binding of the substrate to the active site of an enzyme increases the binding affinity. Other than hydrophobic interaction, there are three other mechanisms, like Vander Waal, hydrogen bond and electrostatic force of interaction, which also promotes E-S complex formation.

Flexibility

An active site shows flexibility as it can change its conformation to mediate substrates’ conversion into products.

Reactivity

The active site of an enzyme reacts with the specific substrate. Its reactivity depends on the environmental conditions like temperature, pH, enzyme and substrate concentration, etc. The enzyme’s active site combines with the substrate and thereby reduces the activation energy to further catalyze the reaction.

Net charge

The active site mainly consists of non-polar amino acid residues, which carry no charge or zero net charge. Some active site also consists of polar amino acids, which carry both positive and negative charge. The net charge of the catalytic site decides which amino acid will bind with the enzyme. There must be a complementary pairing between the active site and the substrate. The same charge on both the catalytic site and substrate will not form an E-S complex as repulsion may result between the two.

Role of Active Site

As we have discussed the active site performs two major activities like:

  • The binding of a substrate with an enzyme.
  • The catalytic activity by converting substrate into product.

Let us assume two conditions one is the conversion of substrate into a product without enzyme and second in an enzyme’s presence.

First condition

In the first condition, we will discuss the substrate’s transition reaction into a product in the absence of an enzyme catalyst. For this, plot a graph between reaction direction and energy. In the absence of a “Catalyst”, a substrate (S) will require higher “Activation energy” to go into the transition state, which we will represent as “St”. In the transition state, the substrate will change its conformation and thereby release a product (P).

Second condition

Here, we will discuss the transition reaction of the substrate into a product in the presence of an enzyme catalyst. For this also, plot a graph between reaction direction and energy. In the presence of a “Catalyst”, a substrate (S) will bind to an enzyme’s catalytic site. The enzyme is a catalytic agent, which will mediate catalysis of a substrate.

The enzyme will modify the substrate and take it to the transition state, which we will represent as “ESt”. In the transition state, the enzyme and substrate will react, and there a change occurs in the substrate’s configuration. This change will lead to the formation of the enzyme product complex and finally release a product (P).


3. Methods

The methodology presented is suitable for the analysis of chromatin structure in vivo and can assist in the mapping of DNA-protein interactions and to elucidate their mechanistic implications regarding various nuclear processes including transcriptional regulation, DNA repair, and replication. The requirements for this procedure include 1) the genomic DNA of interest contains sequence-specific binding sites for and responds to a specific transcription factors and 2) has a restriction enzyme cleavage site located proximal to the binding region and is contained within the confines of a nucleosome or organized as chromatin.

3.1. Cell Culture

The experimental procedure outlined below is based on studies in human carcinoma cells that were stably transformed to contain multiple copies of the nuclear receptor-dependent MMTV promoter. For the purpose of this protocol, we have selected the human adrenal carcinoma cell line, SW-13, which do not express BRG1 protein (10). The use of this multi-copy promoter cell lines provides a very strong signal-to-noise ratio for the MMTV sequence, as well as, to enhance the ability to define the chromatin structure of the promoter. The use of this cell line has greatly enhanced our ability to study nuclear receptor-initiated cascades that lead to structural changes within chromatin upon receptor binding to specific hormone response elements within target promoters (16, 17). Therefore, these general growth conditions have been optimized for our established SW-13/MMTV cell line. Specific growth requirements may vary from this description depending on cell type used.

3.2. Isolation of nuclei

This protocol will outline the standard procedure for nuclei isolation from tissue cultured cells. All steps are performed on ice with pre-chilled equipment and solutions at 4ଌ. Cells were treated with hormone or vehicle prior to nuclei isolation to stimulate glucocorticoid receptor signaling.

Treat cells with 100 nM Dex or vehicle for 1 h prior to nuclei isolation.

Rinse cells with cold PBS and detach from 150mm plates by scraping cells into 10 ml cold PBS. Transfer cells to a pre-chilled 15-ml conical centrifuge tube.

Pellet cells by centrifugation at 500 × g for 5 min at 4ଌ. Remove PBS from cell pellet.

Add cold homogenization buffer (5 ml) and gently to dislodge cell pellet by pipetting. Transfer cells and buffer to a pre-chilled 7-ml Dounce tissue grinder/homogenizer and incubate on ice for 2 min.

Lyse cells by gently using four complete strokes of the Dounce pestle (tight pestle). Transfer lysate to a pre-chilled 15-ml conical tube. (see Note 7)

Gently add 1 ml sucrose pad directly to the bottom of the tube using a micropipette.

Sediment nuclei through sucrose pad by centrifugation at 1400 × g for 20 min at 4ଌ. Delicately remove supernatant from nuclei pellet.

Add 1-ml wash buffer to nuclei and gently resuspend pellet using a micropipette. Once fully in solution, add an additional 4-ml wash buffer and centrifuge at 750 × g for 5 min at 4ଌ.

Carefully remove all traces of wash buffer and store nuclei on ice.

3.3. In vivo Digestion by Restriction Endonuclease

The choice of restriction endonuclease to use for this accessibility assay is dependent upon the availability of cleavage sites within the genomic region of interest. Most analysis will require the testing of numerous restriction enzymes found to cleave within the target sequence until an optimal enzyme(s) is identified. The cleavage buffer selected for this assay was chosen because it maintains the structural integrity of the nuclei and is compatible with a broad range of restriction enzymes (see Note 8). The quantity of enzyme to use should be derived empirically and will depend on the efficiency at which the enzyme cleaves DNA when using the buffer recommended for hypersensitivity assays.

Gently resuspend nuclei in cold restriction enzyme digestion buffer (use a 3:1 ration of buffer to nuclei pellet i.e. resuspend a 50 μl compact nuclei pellet in 150 μl buffer). Transfer aliquots of 100 μl nuclei to pre-chilled 5-ml polypropylene tubes (Falcon 2063).

Digest nuclei with appropriate restriction endonuclease (100-1000U/ml) at 30ଌ for 15 min (in vivo digest). Use 100μl resuspended nuclei for each digest.

Stop reactions by adding 1-ml Proteinase K buffer. Mix each sample by inverting five times and incubate overnight at 37ଌ.

Purify total DNA by four extractions with phenol/chloroform/isoamyl alcohol (PCI-25:24:1, v/v) and two extractions with chloroform. The first two extractions should be carried out with twice the volume PCI (2.0 ml) and each subsequent extraction with one volume (1.0 ml). Mix samples by vigorous shaking and centrifuge at 10,000 × g for 5 min at room temperature.

Precipitate the DNA by addition of 1/10 th volume of 1 m NaCl and 3 volumes ice-cold 95% ethanol. Incubate samples at �ଌ for 1 h then pellet the DNA by centrifugation at 12,000 × g for 30 min at 4ଌ.

Wash DNA pellet with 1-ml cold 70% (v/v) ethanol and centrifuge at 12,000g for 10 min at 4ଌ.

Allow DNA pellet to air-dry for 1 h at room temperature, resuspend in 100 μl sterile water, and transfer to 1.5-ml microfuge tube. (see Note 9).

3.4. In vitro Re-digestion and Purification of DNA

The purified in vivo digested genomic DNA is cut to completion with a second restriction endonuclease which recognizes a cleavage site upstream or downstream of the in vivo restriction enzyme site depending on which template strand is to be extended. This in vitro digestion is performed overnight usually with 100U of endonuclease to ensure complete digestion of the target sequence. The in vitro digest serves as an internal control to ensure equal amounts of DNA template was used in the reiterative primer extension reaction.

Digest DNA to completion with a second restriction enzyme recognizing a site upstream of the in vivo restriction enzyme site. Use 100 Units of enzyme with manufacture’s provided buffer according to manufacturer’s instructions (in vitro digest). Incubate reaction overnight at 37ଌ. (see Note 10)

Purify digested DNA by two extractions with phenol/chloroform/isoamyl alcohol (PCI-25:24:1, v/v) and one extractions with chloroform. Mix samples by vigorous shaking and centrifuge at high speed (20,800 × g) for 5 min at room temperature.

Precipitate the DNA by addition of 625 μl ice-cold 95% ethanol and 5 μl 5 M NaCl. Incubate samples at �ଌ for 30 min and pellet the DNA by centrifuge at high speed (20,800 × g) for 30 min at 4ଌ.

Allow DNA pellet to air-dry for 1 h at room temperature, resuspend in 100 μl sterile water, and determine DNA concentration by A260/280 absorbance reading.

3.5. End labeling of Sequence-specific oligonucleotides

End-labeling is a rapid and sensitive method for radioactively labeling DNA fragments such as oligonucleotide and is useful for visualizing small amounts of DNA. All of the enzymes employed are specific to either the 3′ or 5′ termini of DNA and will, consequently, only incorporate one radio-phosphate per oligonucleotide. The most common method of radio-labeling oligonucleotides uses polynucleotide kinase (PNK) to transfer a single radioactive phosphate group from γ-32P-ATP to the 5′-end of the oligonucleotide.

In a 1.5-ml microfuge tube add the following in the order indicated combine PCR-grade water for a total volume of 20 μl, 2 μl 10X T4 polynucleotide kinase buffer (supplied with enzyme), 2 μl target-specific oligonucleotide (5 μM), 50 㯌i ATP, [γ-32P]-6000 Ci/mmol, and 20U T4 polynucleotide kinase.

Mix the reaction by vortex and briefly centrifuge.

Incubate the reaction mixture for 10 min at 37ଌ.

Prepare MicroSpin G-25 columns according to manufacturer’s guidelines.

Pass labeling reaction over readied G-25 column as directed by manufacturer’s protocol.

Determine incorporation of radiolabel (cpm/μl) by liquid scintillation counter measurement.

3.6. Reiterative Primer Extension

The extent of restriction endonuclease hypersensitivity for a given target sequence is determined using reiterative primer extension with Taq polymerase and a template-specific 32P-labeled oligonucleotide. The primer selected to detect restriction endonuclease hypersensitivity regions should be located either upstream or downstream of the transcription factor binding site, ideally 200-300bp from the in vivo cleavage site.

The concentration of Mg and oligonucleotide selected, for primer extension, greatly influences the specificity and yield of the reaction therefore, the amounts of both should be titrated to achieve optimal results. The primer selected should anneal downstream of the in vivo restriction endonuclease cleavage site and be greater than 18 bases in length with melting temperatures ranging between 45 and 70ଌ. The reiterative primer extension/PCR reaction, described above, has been optimized for studies involving the MMTV promoter (10). These conditions may be employed for other steroid-responsive promoters although optimization should be performed. (see Note 11)

Amplify 10-20 μg purified in vivo/in vitro digested genomic DNA in 30 μl PCR reaction mix using 1-5 × 10 6 cpm 32 P-labled sequence-specific oligonucleotide. (see Note 12)

Thermocycler program should include an initial cycle of denaturation at 94ଌ for 4 min, annealing for 60ଌ for 2 min, and primer extension at 72ଌ for 2 min. Follow initial cycle with 29 cycles of 2 min denaturation at 94ଌ, 2 min annealing at 60ଌ, and 2 min primer extension at 72ଌ with final extension for 10 min.

Stop each PCR reaction with addition of 150 μl PCR stop buffer.

Purify extended products by extraction with two rounds of phenol/chloroform/isoamyl alcohol (500 μl) and one round chloroform (500 μl). Mix samples by vortexing for 5 sec and centrifuge at high speed (20,800 × g) for 5 min at room temperature.

Precipitate extension products by addition of 625 μl cold 95% ethanol and 5 μl 5 M NaCl followed by centrifugation at high speed (20,800 × g) for 30 min at 4ଌ. Precipitated products were washed with 70% cold ethanol, recovered by centrifugation (20,800 × g) for 10 min at 4ଌ and allow pellet to air-dry.

3.7. Analysis of Polymerase Extension Products

Primer extension products are resolved on denaturing polyacrylamide gels. Samples should be allowed to electrophorese to yield maximal separation between bands corresponding to the in vivo restriction endonuclease cleavage site and the in vitro extension terminal cleavage site. For the purposes of this procedure, samples were resolved on 38 × 30 cm gels using Sequi-Gen GT nucleic acid sequencing system (see Note 13).

1- Resuspend DNA pellets in 7 μl sample loading buffer, vortex at high speed for 10 sec, briefly centrifuge, heat for 5 min at 95ଌ, vortex again, and re-centrifuge to collect sample.

2- Pour denaturing polyacrylamide gel and pre-run according to manufacture’s specifications.

6- Load primer extension products and separate on denaturing polyacrylamide gel.

7- After electrophoresis, allow gel to cool then transfer to filter paper.

8- Dry gel under vacuum for 1 h at 80ଌ.

9- Expose to PhosphorImager Screen, scan and analyze suing ImageQuant software (see Note 14).


Introduction

Type IIM and Type IV restriction endonucleases (REases) cleave only modified DNA and are inactive on unmodified DNA 1 . They have evolved in the arms race between bacteria and bacteriophages by restricting phage with modified bases in their genomes (reviewed in ref. 2). Type IIM REases such as DpnI (G m6 ATC) 3 , BisI (G m5 CNGC) 4 , GlaI (R m5 CGY) 5 , and MspJI ( m5 CNNR 9/13) 6 cleave modified sites within or close to their recognition sequences at defined positions 7 . In contrast, Type IV REases cleave modified sites randomly and often at a great distance from their recognition sequences (e.g. EcoK_McrBC (R m5 C N(40–3000) R m5 C) 8 , SauUSI (S m5 CNGS) 9 , ScoA3McrA (phosphorothioated sites) 7,10 . Type IIM and IV REases are useful tools for analyzing m5 C-modified sites in mammalian DNAs since hyper-methylation of CpG sites can alter gene expression (e.g. in ref. 11). GlaI has been used to digest hypermethylated cancer genomic DNA (gDNA) and following ligation of adaptors to the digested fragments, the cancer marker region can be selectively amplified and sequenced 11 . GlaI has also been used in a real time activity assay for the human DNA methyltransferase (MTase) DNMT1 12 . The methylation-dependent REases (MDRE) McrBC and FspEI (C m5 C) can be used in qPCR or digital PCR applications to monitor changes in epigenetic markers of clinical DNA samples 13 . DpnI is used to destroy the wild-type (WT) template after PCR, thus reducing the background in PCR-directed mutagenesis experiments (G m6 ATC sites in the template methylated by the E. coli Dam methylase). MspJI-seq (NGS sequencing of an MspJI-cleaved library) has been used to map modified sites in the Arabidopsis genome 14 . While most methylation-dependent REases can cut both m5 C- and hm5 C-modified DNA, REases such as PvuRts1I that prefer to cleave hm5 C-modified DNA are also found in Nature 15,16 . Eco94GmrSD, however, prefers to cleave hm5 C-modified and glucosylated hm5 C T4 DNA GmrSD digests m5 C-containing DNA and unmodified DNA poorly 17,18 .

BisI was first discovered and purified from a bacterial source Bacillus subtilis T30 and it cleaves GCNGC sites when two to four modified m5 C residues are present in its recognition sequence 4,19 . The BisI homologues PkrI and GluI, however, require three to four modified m5 C in GCNGC for enzymatic activity 20,21 . The enzyme yield and purity of all three enzymes are relatively low from the native bacterial sources making their cost prohibitive for widespread applications in diagnostic qPCR and NGS applications. Highly purified enzymes are also a prerequisite for further enzyme characterization and for structure analysis.

The goal of this work was to provide more modification-dependent REases for molecular biology and diagnostic applications. Here we report the cloning and expression of the BisI restriction enzyme gene in E. coli. BisI is the prototype for a new family of methylation-dependent REases since BisI does not share any significant amino acid (aa) sequence homology to the other known Type IIM restriction enzymes such as the DpnI, MspJI, McrBC, Mrr, McrA, ScoA3McrA or SauUSI families. By using the BlastP server at NCBI to search genome sequences in GenBank, we identified over 150 BisI homologs in bacterial genomes with 17% to 100% aa sequence identity. We cloned/expressed some of these genes in E. coli and identified 23 active BisI homologs with varying degrees of m5 C requirement in cleaving modified GCNGC or its variant sites. We found one BisI homolog (Esp638I) with a unique specificity G m5 CS ↓ SG m5 C, but also capable of relaxing its specificity to RCN ↓ NGY. We also determined that some BisI family enzymes cleave hemi-methylated sites with two m5 C in one DNA strand. In addition, we found two BisI homologs with degenerate specificities cleaving unmodified DNA.


NEBuffer Activity/Performance Chart with Restriction Enzymes

NEB&rsquos restriction enzyme buffer system makes your restriction digests easy and convenient. We are able to offer >215 restriction enzymes that cut in a single buffer, CutSmart ® . This improves ease-of-use, especially when performing double digests. In addition to indicating the performance of each enzyme in the 4 NEBuffers, the chart also indicates ligation and recutting, star activity, and whether or not more than 1-site is required for cleavage.

Should you require information on performing restriction enzyme digestions, please refer to Optimizing Restriction Endonuclease Reactions. You can also receive additional support by contacting [email protected]

We are excited to announce that we are in the process of switching all reaction buffers to be BSA-free. Beginning April 2021, NEB will be switching our current BSA-containing reaction buffers (NEBuffer&trade 1.1, 2.1, 3.1 and CutSmart ® Buffer) to Recombinant Albumin (rAlbumin)-containing buffers (NEBuffer r1.1, r2.1, r3.1 and rCutSmart&trade Buffer). We anticipate that this switch may take as long as 6 months to complete. We feel that moving away from animal-containing products is a step in the right direction and are able to offer this enhancement at the same price. Find more details at www.neb.com/BSA-free.

During this transition period, you may receive product with BSA or rAlbumin-containing buffers. NEB has rigorously tested both and has not seen any difference in enzyme performance when using either buffer. Either buffer can be used with your enzyme. All website content will be switched in April to reflect the changes, although you may not receive the new buffer with your product immediately.

Legend

Not Sensitive Impaired
Blocked Impaired by Overlapping
Blocked by Overlapping Impaired by Some Combinations of Overlapping
Blocked by Some Combinations of Overlapping
Enzyme Sequence Supplied NEBuffer % Activity in NEBuffer Heat Inac. Incu. Temp. Diluent Dam Dcm CpG Unit Substrate Notes
r1.1 r2.1 r3.1 rCutSmart
AatII GACGT/C rCutSmart™ Buffer 80°C 37°C B λ DNA
AbaSI CNNNNNNNNNNN/NNNNNNNNNG rCutSmart™ Buffer 25 50 50 100 65°C 25°C C T4 wild-type phage DNA (fully ghmC-modified) e
AccI GT/MKAC rCutSmart™ Buffer 50 50 10 100 80°C 37°C A λ DNA
Acc65I G/GTACC NEBuffer&trade r3.1 10 75* 100 25 65°C 37°C A pBC4 DNA
AciI CCGC(-3/-1) rCutSmart™ Buffer λ DNA
AclI AA/CGTT rCutSmart™ Buffer λ DNA
AcuI CTGAAG(16/14) rCutSmart™ Buffer 50 100 50 100 65°C 37°C B λ DNA 1, b, d
AfeI AGC/GCT rCutSmart™ Buffer 25 100 25 100 65°C 37°C B pXba DNA
AflII C/TTAAG rCutSmart™ Buffer 50 100 10 100 65°C 37°C A ΦX174 RF I DNA
AflIII A/CRYGT NEBuffer&trade r3.1 10 50 100 50 80°C 37°C B λ DNA
AgeI § A/CCGGT NEBuffer&trade r1.1 100 75 25 75 65°C 37°C C λ DNA
AgeI-HF® A/CCGGT rCutSmart™ Buffer 100 50 10 100 65°C 37°C A λ DNA
AhdI GACNNN/NNGTC rCutSmart™ Buffer 25 25 10 100 65°C 37°C A λ DNA a
AleI-v2 CACNN/NNGTG rCutSmart™ Buffer
AluI AG/CT rCutSmart™ Buffer 25 100 50 100 80°C 37°C B λ DNA b
AlwI GGATC(4/5) rCutSmart™ Buffer 50 50 10 100 No 37°C A λ DNA (dam-) 1, b, d
AlwNI CAGNNN/CTG rCutSmart™ Buffer 10 100 50 100 80°C 37°C A λ DNA
ApaI GGGCC/C rCutSmart™ Buffer 25 25 pXba DNA
ApaLI G/TGCAC rCutSmart™ Buffer 100 100 10 100 No 37°C A λ DNA (HindIII digest)
ApeKI G/CWGC NEBuffer&trade r3.1 25 50 100 10 No 75°C B λ DNA
ApoI § R/AATTY NEBuffer&trade r3.1 10 75 100 75 80°C 50°C A λ DNA
ApoI-HF R/AATTY rCutSmart™ Buffer 10 100 10 100 80°C 37°C B λ DNA
AscI GG/CGCGCC rCutSmart™ Buffer 80°C 37°C A λ DNA
AseI AT/TAAT NEBuffer&trade r3.1 λ DNA 3
AsiSI GCGAT/CGC rCutSmart™ Buffer 100 100 25 100 80°C 37°C B XhoI digested pXba 2, b
AvaI C/YCGRG rCutSmart™ Buffer 80°C 37°C A λ DNA
AvaII G/GWCC rCutSmart™ Buffer 50 75 10 100 80°C 37°C A λ DNA
AvrII C/CTAGG rCutSmart™ Buffer 100 50 50 100 No 37°C B λ DNA (HindIII digest)
BaeGI GKGCM/C NEBuffer&trade r3.1 75 75 100 25 80°C 37°C A λ DNA
BaeI (10/15)ACNNNNGTAYC(12/7) rCutSmart™ Buffer + SAM 50 100 50 100 65°C 25°C A λ DNA e
BamHI § G/GATCC NEBuffer&trade r3.1 75* 100* 100 100* No 37°C A λ DNA 3
BamHI-HF® G/GATCC rCutSmart™ Buffer 100 50 10 100 No 37°C A λ DNA
BanI G/GYRCC rCutSmart™ Buffer 10 25 λ DNA 1
BanII GRGCY/C rCutSmart™ Buffer 100 100 50 100 80°C 37°C A λ DNA 2
BbsI § GAAGAC(2/6) NEBuffer&trade r2.1 100 100 25 75 65°C 37°C B λ DNA
BbsI-HF ® GAAGAC(2/6) rCutSmart™ Buffer 10 10 10 100 65°C 37°C B λ DNA
BbvCI CCTCAGC(-5/-2) rCutSmart™ Buffer 10 100 50 100 No 37°C B λ DNA 1, a
BbvI GCAGC(8/12) rCutSmart™ Buffer 100 100 25 100 65°C 37°C B pBR322 DNA 3
BccI CCATC(4/5) rCutSmart™ Buffer 100 50 10 100 65°C 37°C A pXba DNA 3, b
BceAI ACGGC(12/14) NEBuffer&trade r3.1 100* 100* 100 100* 65°C 37°C A pBR322 DNA 1
BcgI (10/12)CGANNNNNNTGC(12/10) NEBuffer&trade r3.1 10 75* 100 50* 65°C 37°C A λ DNA e
BciVI GTATCC(6/5) rCutSmart™ Buffer 100 25 80°C 37°C C λ DNA b
BclI § T/GATCA NEBuffer&trade r3.1 50 100 100 75 No 50°C A λ DNA (dam-)
BclI-HF T/GATCA rCutSmart™ Buffer 100 100 10 100 65°C 37°C B λ DNA (dam-)
BcoDI GTCTC(1/5) rCutSmart™ Buffer 50 75 75 100 No 37°C B λ DNA
BfaI C/TAG rCutSmart™ Buffer 80°C 37°C B λ DNA 2, b
BfuAI ACCTGC(4/8) NEBuffer&trade r3.1 λ DNA 3
BglI GCCNNNN/NGGC NEBuffer&trade r3.1 10 25 100 10 65°C 37°C B λ DNA
BglII A/GATCT NEBuffer&trade r3.1 10 10 100 λ DNA
BlpI GC/TNAGC rCutSmart™ Buffer 50 100 10 100 No 37°C A λ DNA d
BmgBI CACGTC(-3/-3) NEBuffer&trade r3.1 λ DNA 3, b, d
BmrI ACTGGG(5/4) NEBuffer&trade r2.1 75 100 75 100* 65°C 37°C B λ DNA (HindIII digest) b
BmtI § GCTAG/C NEBuffer&trade r3.1 100 100 100 100 + 65°C 37°C B pXba DNA 2
BmtI-HF® GCTAG/C rCutSmart™ Buffer 50 100 10 100 65°C 37°C B pXba DNA
BpmI CTGGAG(16/14) NEBuffer&trade r3.1 75 100 100 100* 65°C 37°C B λ DNA 2
BpuEI CTTGAG(16/14) rCutSmart™ Buffer 50* 100 50* 100 65°C 37°C B λ DNA d
Bpu10I CCTNAGC(-5/-2) NEBuffer&trade r3.1 10 25 100 25 80°C 37°C B λ DNA 3, b, d
BsaAI YAC/GTR rCutSmart™ Buffer 100 100 100 100 No 37°C C λ DNA
BsaBI GATNN/NNATC rCutSmart™ Buffer 50 100 75 100 80°C 60°C B λ DNA (dam-) 2
BsaHI GR/CGYC rCutSmart™ Buffer 50 100 100 100 80°C 37°C C λ DNA
BsaI-HF®v2 GGTCTC(1/5) rCutSmart™ Buffer 100 100 100 100 80°C 37°C B pXba DNA
BsaJI C/CNNGG rCutSmart™ Buffer 50 100 100 100 80°C 60°C A λ DNA
BsaWI W/CCGGW rCutSmart™ Buffer 10 100 50 100 80°C 60°C A λ DNA
BsaXI (9/12)ACNNNNNCTCC(10/7) rCutSmart™ Buffer 50* 100* 10 100 No 37°C C λ DNA e
BseRI GAGGAG(10/8) rCutSmart™ Buffer 100 100 75 100 80°C 37°C A λ DNA d
BseYI CCCAGC(-5/-1) NEBuffer&trade r3.1 10 50 100 50 80°C 37°C B λ DNA d
BsgI GTGCAG(16/14) rCutSmart™ Buffer 25 50 25 100 65°C 37°C B λ DNA d
BsiEI CGRY/CG rCutSmart™ Buffer 25 50 λ DNA
BsiHKAI GWGCW/C rCutSmart™ Buffer 25 100 100 100 No 65°C A λ DNA
BsiWI § C/GTACG NEBuffer&trade r3.1 25 50* 100 25 65°C 55°C B ΦX174 DNA
BsiWI-HF ® C/GTACG rCutSmart™ Buffer 50 100 10 100 No 37°C B ΦX174 DNA
BslI CCNNNNN/NNGG rCutSmart™ Buffer 50 75 100 100 No 55°C A λ DNA b
BsmAI GTCTC(1/5) rCutSmart™ Buffer 50 100 100 100 No 55°C B λ DNA
BsmBI-v2 CGTCTC NEBuffer&trade r3.1 80°C 55°C B
BsmFI GGGAC(10/14) rCutSmart™ Buffer 25 50 50 100 80°C 65°C A pBR322 DNA 1
BsmI GAATGC(1/-1) rCutSmart™ Buffer 25 100 80°C 65°C A λ DNA
BsoBI C/YCGRG rCutSmart™ Buffer 25 100 100 100 80°C 37°C A λ DNA
BspCNI CTCAG(9/7) rCutSmart™ Buffer 100 75 10 100 80°C 37°C A λ DNA b
BspDI AT/CGAT rCutSmart™ Buffer 25 75 50 100 80°C 37°C A λ DNA
BspEI T/CCGGA NEBuffer&trade r3.1 80°C 37°C B λ DNA (dam-)
BspHI T/CATGA rCutSmart™ Buffer 10 50 25 100 80°C 37°C A λ DNA
Bsp1286I GDGCH/C rCutSmart™ Buffer 25 25 25 100 65°C 37°C A λ DNA 3
BspMI ACCTGC(4/8) NEBuffer&trade r3.1 10 50* 100 10 65°C 37°C B λ DNA
BspQI GCTCTTC(1/4) NEBuffer&trade r3.1 100* 100* 100 100* 80°C 50°C B λ DNA 3
BsrBI CCGCTC(-3/-3) rCutSmart™ Buffer 50 100 100 100 80°C 37°C A λ DNA d
BsrDI GCAATG(2/0) NEBuffer&trade r2.1 10 100 75 25 80°C 65°C A λ DNA 3, d
BsrFI-v2 R/CCGGY rCutSmart™ Buffer 25 25 0 100 No 37°C C pBR322 DNA
BsrGI § T/GTACA NEBuffer&trade r2.1 25 100 100 25 80°C 37°C A λ DNA
BsrGI-HF® T/GTACA rCutSmart™ Buffer 10 100 100 100 80°C 37°C A λ DNA
BsrI ACTGG(1/-1) NEBuffer&trade r3.1 80°C 65°C B ΦX174 DNA b
BssHII G/CGCGC rCutSmart™ Buffer 100 100 100 100 65°C 50°C B λ DNA
BssSI-v2 CACGAG(-5/-1) rCutSmart™ Buffer 10 25 λ DNA
BstAPI GCANNNN/NTGC rCutSmart™ Buffer 50 100 25 100 80°C 60°C A λ DNA b
BstBI TT/CGAA rCutSmart™ Buffer 75 100 10 100 No 65°C A λ DNA
BstEII § G/GTNACC NEBuffer&trade r3.1 10 75* 100 75* No 60°C A λ DNA 3
BstEII-HF® G/GTNACC rCutSmart™ Buffer λ DNA
BstNI CC/WGG NEBuffer&trade r3.1 10 100 100 75 No 60°C A λ DNA a
BstUI CG/CG rCutSmart™ Buffer 50 100 25 100 No 60°C A λ DNA b
BstXI CCANNNNN/NTGG NEBuffer&trade r3.1 80°C 37°C B λ DNA 3
BstYI R/GATCY NEBuffer&trade r2.1 25 100 75 100 No 60°C A λ DNA
BstZ17I-HF ® GTATAC rCutSmart™ Buffer 100 100 10 100 No 37°C A λ DNA
Bsu36I CC/TNAGG rCutSmart™ Buffer 25 100 100 100 80°C 37°C C λ DNA (HindIII digest) b
BtgI C/CRYGG rCutSmart™ Buffer 50 100 100 100 80°C 37°C B pBR322 DNA
BtgZI GCGATG(10/14) rCutSmart™ Buffer 10 25 80°C 60°C A λ DNA 3, b, d
BtsCI GGATG(2/0) rCutSmart™ Buffer 10 100 25 100 80°C 50°C B λ DNA
BtsIMutI CAGTG(2/0) rCutSmart™ Buffer 100 50 10 100 80°C 55°C A pUC19 DNA b
BtsI-v2 GCAGTG(2/0) rCutSmart™ Buffer 100 100 25 100 No 37°C A λ DNA 1
Cac8I GCN/NGC rCutSmart™ Buffer 50 75 100 100 65°C 37°C B λ DNA b
ClaI AT/CGAT rCutSmart™ Buffer 10 50 50 100 65°C 37°C A λ DNA (dam-)
CspCI (11/13)CAANNNNNGTGG(12/10) rCutSmart™ Buffer 10 100 10 100 65°C 37°C A λ DNA e
CviAII C/ATG rCutSmart™ Buffer 50 50 10 100 65°C 25°C C λ DNA
CviKI-1 RG/CY rCutSmart™ Buffer 25 100 100 100 No 37°C A pBR322 DNA 1, b
CviQI G/TAC NEBuffer&trade r3.1 75 100* 100 75* No 25°C C λ DNA b
DdeI C/TNAG rCutSmart™ Buffer 75 100 100 100 65°C 37°C B λ DNA
DpnI GA/TC rCutSmart™ Buffer 100 100 75 100 80°C 37°C B pBR322 DNA (dam methylated) b
DpnII /GATC NEBuffer&trade DpnII 25 25 100* 25 65°C 37°C B λ DNA (dam-)
DraI TTT/AAA rCutSmart™ Buffer 75 75 50 100 65°C 37°C A λ DNA
DraIII-HF® CACNNN/GTG rCutSmart™ Buffer λ DNA b
DrdI GACNNNN/NNGTC rCutSmart™ Buffer 25 50 10 100 65°C 37°C A pUC19 DNA 3
EaeI Y/GGCCR rCutSmart™ Buffer 10 50 λ DNA b
EagI-HF® C/GGCCG rCutSmart™ Buffer 25 100 100 100 65°C 37°C B pXba DNA
EarI CTCTTC(1/4) rCutSmart™ Buffer 50 10 λ DNA b, d
EciI GGCGGA(11/9) rCutSmart™ Buffer 100 50 50 100 65°C 37°C A λ DNA 2
Eco53kI GAG/CTC rCutSmart™ Buffer 100 100 pXba DNA 3, b
EcoNI CCTNN/NNNAGG rCutSmart™ Buffer 50 100 75 100 65°C 37°C A λ DNA b
EcoO109I RG/GNCCY rCutSmart™ Buffer 50 100 50 100 65°C 37°C A λ DNA (HindIII digest) 3
EcoP15I CAGCAG(25/27) NEBuffer&trade r3.1 + ATP 75 100 100 100 65°C 37°C A pUC19 DNA e
EcoRI § G/AATTC NEBuffer™ EcoRI/SspI 25 100* 50 50* 65°C 37°C C λ DNA
EcoRI-HF® G/AATTC rCutSmart™ Buffer 10 100 λ DNA
EcoRV § GAT/ATC NEBuffer&trade r3.1 10 50 100 10 80°C 37°C A λ DNA
EcoRV-HF® GAT/ATC rCutSmart™ Buffer 25 100 100 100 65°C 37°C B λ DNA
Esp3I CGTCTC(1/5) rCutSmart™ Buffer 100 100 λ DNA
FatI /CATG NEBuffer&trade r2.1 10 100 50 50 80°C 55°C A pUC19 DNA
FauI CCCGC(4/6) rCutSmart™ Buffer 100 50 10 100 65°C 55°C A λ DNA 3, b, d
Fnu4HI GC/NGC rCutSmart™ Buffer λ DNA a
FokI GGATG(9/13) rCutSmart™ Buffer 100 100 75 100 65°C 37°C A λ DNA 3, b, d
FseI GGCCGG/CC rCutSmart™ Buffer 100 75 pBC4 DNA
FspEI CC(12/16) rCutSmart™ Buffer 80°C 37°C B pBR322 (dcm+) DNA 1, e
FspI TGC/GCA rCutSmart™ Buffer 10 100 10 100 No 37°C C λ DNA b
HaeII RGCGC/Y rCutSmart™ Buffer 25 100 10 100 80°C 37°C A λ DNA
HaeIII GG/CC rCutSmart™ Buffer 50 100 25 100 80°C 37°C A λ DNA
HgaI GACGC(5/10) NEBuffer&trade r1.1 100 100 25 100* 65°C 37°C A ΦX174 DNA 1
HhaI GCG/C rCutSmart™ Buffer 25 100 100 100 65°C 37°C A λ DNA
HincII GTY/RAC NEBuffer&trade r3.1 25 100 100 100 65°C 37°C B λ DNA
HindIII § A/AGCTT NEBuffer&trade r2.1 25 100 50 50 80°C 37°C B λ DNA 2
HindIII-HF® A/AGCTT rCutSmart™ Buffer 10 100 10 100 80°C 37°C B λ DNA
HinfI G/ANTC rCutSmart™ Buffer 50 100 100 100 80°C 37°C A λ DNA
HinP1I G/CGC rCutSmart™ Buffer 100 100 100 100 65°C 37°C A λ DNA
HpaI GTT/AAC rCutSmart™ Buffer λ DNA 1
HpaII C/CGG rCutSmart™ Buffer 100 50 80°C 37°C A λ DNA
HphI GGTGA(8/7) rCutSmart™ Buffer 50 50 λ DNA 1, b, d
HpyAV CCTTC(6/5) rCutSmart™ Buffer 100 100 25 100 65°C 37°C λ DNA 3, b, d
HpyCH4III ACN/GT rCutSmart™ Buffer 100 25 λ DNA b
HpyCH4IV A/CGT rCutSmart™ Buffer 100 50 25 100 65°C 37°C A pUC19 DNA
HpyCH4V TG/CA rCutSmart™ Buffer 50 50 25 100 65°C 37°C A λ DNA
Hpy188I TCN/GA rCutSmart™ Buffer 25 100 50 100 65°C 37°C A pBR322 DNA 1, b
Hpy99I CGWCG/ rCutSmart™ Buffer 50 10 λ DNA
Hpy166II GTN/NAC rCutSmart™ Buffer 100 100 50 100 65°C 37°C C pBR322 DNA
Hpy188III TC/NNGA rCutSmart™ Buffer 100 100 10 100 65°C 37°C B pUC19 DNA 3, b
I-CeuI TAACTATAACGGTCCTAAGGTAGCGAA(-9/-13) rCutSmart™ Buffer 10 10 10 100 65°C 37°C B pBHS ScaI-linearized Control Plasmid
I-SceI TAGGGATAACAGGGTAAT(-9/-13) rCutSmart™ Buffer 10 50 25 100 65°C 37°C B pGPS2 NotI-linearized Control Plasmid
KasI G/GCGCC rCutSmart™ Buffer 50 100 50 100 65°C 37°C B pBR322 DNA 3
KpnI § GGTAC/C NEBuffer&trade r1.1 100 75 pXba DNA 1
KpnI-HF® GGTAC/C rCutSmart™ Buffer 100 25 pXba DNA
LpnPI CCDG(10/14) rCutSmart™ Buffer pBR322 (dcm+) DNA 1, e
MboI /GATC rCutSmart™ Buffer 75 100 100 100 65°C 37°C A λ DNA (dam-)
MboII GAAGA(8/7) rCutSmart™ Buffer 100* 100 50 100 65°C 37°C C λ DNA (dam-) b
MfeI § C/AATTG rCutSmart™ Buffer 75 50 10 100 No 37°C A λ DNA 2
MfeI-HF® C/AATTG rCutSmart™ Buffer 75 25 λ DNA
MluCI /AATT rCutSmart™ Buffer 100 10 10 100 No 37°C A λ DNA
MluI § A/CGCGT NEBuffer&trade r3.1 10 50 100 25 80°C 37°C A λ DNA
MluI-HF® A/CGCGT rCutSmart™ Buffer 25 100 100 100 No 37°C A λ DNA
MlyI GAGTC(5/5) rCutSmart™ Buffer 50 50 10 100 65°C 37°C A λ DNA b, d
MmeI TCCRAC(20/18) rCutSmart™ Buffer 50 100 50 100 65°C 37°C B ΦX174 RF I DNA b, c
MnlI CCTC(7/6) rCutSmart™ Buffer 75 100 50 100 65°C 37°C B λ DNA b
MscI TGG/CCA rCutSmart™ Buffer 25 100 100 100 80°C 37°C C λ DNA
MseI T/TAA rCutSmart™ Buffer 75 100 75 100 65°C 37°C A λ DNA
MslI CAYNN/NNRTG rCutSmart™ Buffer 50 50 80°C 37°C A λ DNA
MspA1I CMG/CKG rCutSmart™ Buffer 10 50 10 100 65°C 37°C B λ DNA
MspI C/CGG rCutSmart™ Buffer 75 100 50 100 No 37°C A λ DNA
MspJI CNNR(9/13) rCutSmart™ Buffer pBR322 (dcm+) DNA 1, e
MwoI GCNNNNN/NNGC rCutSmart™ Buffer λ DNA
NaeI GCC/GGC rCutSmart™ Buffer 25 25 pXba DNA b
NarI GG/CGCC rCutSmart™ Buffer 100 100 10 100 65°C 37°C A pXba DNA
Nb.BbvCI CCTCAGC rCutSmart™ Buffer 25 100 100 100 80°C 37°C A supercoiled plasmid DNA e
Nb.BsmI GAATGC NEBuffer&trade r3.1 80°C 65°C A supercoiled plasmid pBR322 DNA e
Nb.BsrDI GCAATG rCutSmart™ Buffer 25 100 100 100 80°C 65°C A supercoiled pUC19 DNA e
Nb.BssSI CACGAG NEBuffer&trade r3.1 10 100 100 25 No 37°C B supercoiled pUC19 DNA e
Nb.BtsI GCAGTG rCutSmart™ Buffer 75 100 75 100 80°C 37°C A supercoiled pUC101 DNA (dam-/dcm-) e
NciI CC/SGG rCutSmart™ Buffer 100 25 10 100 No 37°C A λ DNA b
NcoI § C/CATGG NEBuffer&trade r3.1 100 100 100 100 + 80°C 37°C A λ DNA
NcoI-HF® C/CATGG rCutSmart™ Buffer 50 100 10 100 80°C 37°C B λ DNA
NdeI CA/TATG rCutSmart™ Buffer 75 100 100 100 65°C 37°C A λ DNA
NgoMIV G/CCGGC rCutSmart™ Buffer 100 50 10 100 No 37°C A pXba DNA 1
NheI-HF® G/CTAGC rCutSmart™ Buffer 100 25 10 100 80°C 37°C C λ DNA (HindIII digest)
NlaIII CATG/ rCutSmart™ Buffer ΦX174 RF I DNA
NlaIV GGN/NCC rCutSmart™ Buffer 10 10 10 100 65°C 37°C B pBR322 DNA
NmeAIII GCCGAG(21/19) rCutSmart™ Buffer 10 10 ΦX174 RF I DNA c
NotI § GC/GGCCGC NEBuffer&trade r3.1 pBC4 DNA
NotI-HF® GC/GGCCGC rCutSmart™ Buffer 25 100 25 100 65°C 37°C A pBC4 DNA
NruI § TCG/CGA NEBuffer&trade r3.1 λ DNA b
NruI-HF® TCG/CGA rCutSmart™ Buffer 0 25 50 100 No 37°C A λ DNA
NsiI § ATGCA/T NEBuffer&trade r3.1 10 75 100 25 65°C 37°C B λ DNA
NsiI-HF® ATGCA/T rCutSmart™ Buffer 80°C 37°C B λ DNA
NspI RCATG/Y rCutSmart™ Buffer 100 100 λ DNA
Nt.AlwI GGATC(4/-5) rCutSmart™ Buffer 10 100 100 100 80°C 37°C A pUC101 DNA (dam-/dcm-) e
Nt.BbvCI CCTCAGC(-5/-7) rCutSmart™ Buffer 50 100 10 100 80°C 37°C A supercoiled plasmid DNA e
Nt.BsmAI GTCTC(1/-5) rCutSmart™ Buffer 100 50 10 100 65°C 37°C A supercoiled plasmid DNA e
Nt.BspQI GCTCTTC(1/-7) NEBuffer&trade r3.1 80°C 50°C B supercoiled pUC19 DNA e
Nt.BstNBI GAGTC(4/-5) NEBuffer&trade r3.1 0 10 100 10 80°C 55°C A T7 DNA e
Nt.CviPII (0/-1)CCD rCutSmart™ Buffer 10 100 25 100 65°C 37°C A pUC19 DNA e
PacI TTAAT/TAA rCutSmart™ Buffer 100 75 10 100 65°C 37°C A pNEB193 DNA
PaeR7I C/TCGAG rCutSmart™ Buffer 25 100 10 100 No 37°C A λ DNA (HindIII digest)
PaqCI CACCTGC(4/8) rCutSmart™ Buffer 10 100 10 100 65°C 37°C B λ DNA 1
PciI A/CATGT NEBuffer&trade r3.1 50 75 100 50* 80°C 37°C B pXba DNA
PflFI GACN/NNGTC rCutSmart™ Buffer 25 100 25 100 65°C 37°C A pBC4 DNA b
PflMI CCANNNN/NTGG NEBuffer&trade r3.1 0 100 100 50 65°C 37°C A λ DNA 3, b, d
PI-PspI TGGCAAACAGCTATTATGGGTATTATGGGT(-13/-17) NEBuffer&trade PI-PspI + BSA 10 10 10 10 No 65°C B pAKR7 XmnI-linearized Control Plasmid
PI-SceI ATCTATGTCGGGTGCGGAGAAAGAGGTAAT(-15/-19) NEBuffer™ PI-SceI + BSA 10 10 10 10 65°C 37°C B pBSvdeX XmnI-linearized Control Plasmid
PleI GAGTC(4/5) rCutSmart™ Buffer 25 50 25 100 65°C 37°C A λ DNA b, d
PluTI GGCGC/C rCutSmart™ Buffer 100 25 pXba DNA b
PmeI GTTT/AAAC rCutSmart™ Buffer λ DNA
PmlI CAC/GTG rCutSmart™ Buffer 100 50 λ DNA (HindIII digest) DNA
PpuMI RG/GWCCY rCutSmart™ Buffer λ DNA (HindIII digest)
PshAI GACNN/NNGTC rCutSmart™ Buffer 25 50 10 100 65°C 37°C A λ DNA
PsiI-v2 TTA/TAA rCutSmart™ Buffer 25 50 10 100 65°C 37°C B λ DNA 3
PspGI /CCWGG rCutSmart™ Buffer 25 100 50 100 No 75°C A T7 DNA 3
PspOMI G/GGCCC rCutSmart™ Buffer 10 10 pXba DNA
PspXI VC/TCGAGB rCutSmart™ Buffer λ DNA (HindIII digest)
PstI § CTGCA/G NEBuffer&trade r3.1 75 75 100 50* 80°C 37°C C λ DNA
PstI-HF® CTGCA/G rCutSmart™ Buffer 10 75 50 100 No 37°C C λ DNA
PvuI § CGAT/CG NEBuffer&trade r3.1 pXba DNA
PvuI-HF® CGAT/CG rCutSmart™ Buffer 25 100 100 100 No 37°C B pXba DNA
PvuII § CAG/CTG NEBuffer&trade r3.1 50 100 100 100* No 37°C B λ DNA
PvuII-HF® CAG/CTG rCutSmart™ Buffer λ DNA
RsaI GT/AC rCutSmart™ Buffer 25 50 λ DNA
RsrII CG/GWCCG rCutSmart™ Buffer 25 75 10 100 65°C 37°C C λ DNA
SacI § GAGCT/C NEBuffer&trade r1.1 100 50 10 100 + 65°C 37°C A λ DNA (HindIII digest)
SacI-HF® GAGCT/C rCutSmart™ Buffer 10 50 λ DNA (HindIII digest)
SacII CCGC/GG rCutSmart™ Buffer 10 100 10 100 65°C 37°C A pXba DNA
SalI § G/TCGAC NEBuffer&trade r3.1 λ DNA (HindIII digest)
SalI-HF® G/TCGAC rCutSmart™ Buffer 10 100 100 100 65°C 37°C A λ DNA (HindIII digest)
SapI GCTCTTC(1/4) rCutSmart™ Buffer 75 50 λ DNA
Sau3AI /GATC NEBuffer&trade r1.1 100 50 10 100 + 65°C 37°C A λ DNA b
Sau96I G/GNCC rCutSmart™ Buffer 50 100 100 100 65°C 37°C A λ DNA
SbfI § CCTGCA/GG rCutSmart™ Buffer 50 25 80°C 37°C A λ DNA 3
SbfI-HF® CCTGCA/GG rCutSmart™ Buffer 50 25 80°C 37°C B λ DNA
ScaI-HF® AGT/ACT rCutSmart™ Buffer 100 100 10 100 80°C 37°C B λ DNA
ScrFI CC/NGG rCutSmart™ Buffer 100 100 100 100 65°C 37°C C λ DNA 2, a
SexAI A/CCWGGT rCutSmart™ Buffer 100 75 50 100 65°C 37°C A pBC4 DNA (dcm-) 3, b, d
SfaNI GCATC(5/9) NEBuffer&trade r3.1 ΦX174 RF I DNA 3, b
SfcI C/TRYAG rCutSmart™ Buffer 75 50 25 100 65°C 37°C B λ DNA 3
SfiI GGCCNNNN/NGGCC rCutSmart™ Buffer 25 100 50 100 No 50°C C pXba DNA
SfoI GGC/GCC rCutSmart™ Buffer 50 100 100 100 No 37°C B λ DNA (HindIII digest)
SgrAI CR/CCGGYG rCutSmart™ Buffer 100 100 10 100 65°C 37°C A λ DNA 1
SmaI CCC/GGG rCutSmart™ Buffer λ DNA (HindIII digest) b
SmlI C/TYRAG rCutSmart™ Buffer 25 75 25 100 No 55°C A λ DNA b
SnaBI TAC/GTA rCutSmart™ Buffer 50* 50 10 100 80°C 37°C A T7 DNA 1
SpeI § A/CTAGT rCutSmart™ Buffer 75 100 25 100 80°C 37°C C pXba-XbaI DNA
SpeI-HF® A/CTAGT rCutSmart™ Buffer 25 50 10 100 80°C 37°C C pXba-XbaI DNA
SphI § GCATG/C NEBuffer&trade r2.1 100 100 50 100 + 65°C 37°C B λ DNA 2
SphI-HF® GCATG/C rCutSmart™ Buffer 50 25 10 100 65°C 37°C B λ DNA
SrfI GCCC/GGGC rCutSmart™ Buffer 10 50 0 100 65°C 37°C B pNEB193-SrfI DNA
SspI § AAT/ATT NEBuffer™ EcoRI/SspI 50 100 50 50 65°C 37°C C λ DNA
SspI-HF® AAT/ATT rCutSmart™ Buffer 25 100 λ DNA
StuI AGG/CCT rCutSmart™ Buffer 50 100 50 100 No 37°C A λ DNA
StyD4I /CCNGG rCutSmart™ Buffer 10 100 100 100 65°C 37°C B λ DNA
StyI-HF® C/CWWGG rCutSmart™ Buffer 25 100 25 100 65°C 37°C A λ DNA
SwaI ATTT/AAAT NEBuffer&trade r3.1 10 10 100 10 65°C 25°C B pXba DNA b, d
TaqI-v2 T/CGA rCutSmart™ Buffer 50 100 50 100 No 65°C B λ DNA
TfiI G/AWTC rCutSmart™ Buffer 50 100 100 100 No 65°C C λ DNA
TseI G/CWGC rCutSmart™ Buffer 75 100 100 100 No 65°C B λ DNA 3
Tsp45I /GTSAC rCutSmart™ Buffer 100 50 λ DNA
TspMI C/CCGGG rCutSmart™ Buffer 50* 75* 50* 100 No 75°C B pUCAdeno plasmid DNA d
TspRI NNCASTGNN/ rCutSmart™ Buffer 25 50 25 100 No 65°C B λ DNA
Tth111I GACN/NNGTC rCutSmart™ Buffer 25 100 25 100 No 65°C B pBC4 DNA b
XbaI T/CTAGA rCutSmart™ Buffer λ DNA (dam-/Hind III digest)
XcmI CCANNNNN/NNNNTGG NEBuffer&trade r2.1 10 100 25 100* 65°C 37°C C λ DNA 2
XhoI C/TCGAG rCutSmart™ Buffer 75 100 100 100 65°C 37°C A λ DNA (HindIII digest) b
XmaI C/CCGGG rCutSmart™ Buffer 25 50 pXba DNA 3
XmnI GAANN/NNTTC rCutSmart™ Buffer 50 75 λ DNA b
ZraI GAC/GTC rCutSmart™ Buffer 100 25 10 100 80°C 37°C B λ DNA

§ An HF version of this enzyme is available.

Ligation and Recutting Notes

The following notes appear with any enzymes having ligation efficiencies lower than 100% as assessed by ligation and recutting.

a. Ligation is less than 10%.
b. Ligation is 25% -75%.
c. Recutting after ligation is less than 5%.
d. Recutting after ligation is 50% -75%.
e. Ligation and recutting after ligation is not applicable since the enzyme is either a nicking enzyme, is affected by methylation, or if the enzyme cleaves outside its recognition sequence.

Star Activity Notes

The following notes appear with any enzymes when star activity is a concern.

1. Star Activity may result from extended digestion, high enzyme concentration or a glycerol concentration of > 5%.
2. Star Activity may result from extended digestion.
3. Star Activity may result from a glycerol concentration of > 5%.
*. May exhibit star activity in this buffer.
+. For added flexibility, NEB offers an isoschizomer or HF enzyme, supplied with CutSmart Buffer.


Restriction Enzyme Activity

Restriction enzymes differ in their reaction kinetics. As a result, variations from the recommended incubation time, number of units used, substrate amount, and/or total reaction volume should be considered carefully to ensure complete digestion. The following table gives an indication of the activity of Promega blue/white cloning-qualified and genome-qualified restriction enzymes under varying reaction conditions. Variations in the number of enzyme units used and the reaction incubation times were tested. In each case the reaction volume (50µl) and the amount/type of DNA substrate (1µg) were the same as that used in the unit definition assay. Incubation time for the unit definition assay is one hour.

Table 2.2. Restriction Enzyme Activity under Nonstandard Units and Incubation Time Conditions.
Enzyme Reaction Time and Number of Units Used
15 min.
4 units
15 min.
2 units
15 min.
1 unit
30 min.
2 units
1 hr
1 unit
2 hr
0.5 units
4 hr
0.25 units
AatII C I I C C C C
AccI C C C C C C I
Acc65I C I I C C I I
ApaI C I I C C C C
AvaI C C I C C C C
BamHI C C I C C I I
BbuI C I I I C C C
Bcl I C I I C C C C
Bgl I C I I C C C C
BstXI C I I C C C C
BstZI I I I C C C C
ClaI C I I C C C C
CspI C I I C C I I
Csp45I C I I C C C C
Eco52I C I I C C I I
EcoRI C I I C C C C
EcoRV C I I C C C C
HincII C I I C C C C
HindIII C I I I C C C
KpnI C I I C C C C
MluI C I I C C C C
NcoI C I I C C C C
NheI C I I C C C C
NotI C I I C C C I
NsiI C I I C C C C
PstI C I I C C C C
SacI C I I C C C C
SacII C I I C C C C
Sal I C C C C C C I
SfiI C I I C C C C
SmaI C C I C C C C
SpeI C I I C C I I
SphI C C C C C I I
SspI C I I C C C C
StyI C I I C C I I
XbaI C I I C C C C
XhoI C I I C C C C
XmaI C I I C C C C

"C" indicates complete cleavage "I" indicates incomplete cleavage for the units and incubation times shown.


Restriction Enzyme Substrate Considerations

A. Substrate Source and Structure

Substrates commonly used for restriction enzyme digestion include phage DNA, plasmid DNA, genomic DNA, PCR products and double-stranded oligonucleotides. The concentration of the DNA sample can influence the success of a restriction digestion. Viscous DNA solutions, resulting from large amounts of DNA in too small of a volume, can inhibit diffusion and can significantly reduce enzyme activity (1) . DNA concentrations that are too low also may inhibit enzyme activity (see Substrate Quality). Typical Km values for restriction enzymes are between 1nM and 10nM, and are template-dependent (2) . Recommended final DNA concentrations for digestion range from 0.02-0.2µg/µl. Substrate structural variations, concentration and special considerations are discussed below according to DNA type.

Lambda DNA: Lambda DNA is a linear DNA that is an industry standard for the measurement and expression of unit activity for most restriction enzymes. In general, one unit is sufficient to cut 1µg of lambda DNA in 1 hour under optimal reaction conditions in a reaction volume of 50µl. In lambda DNA, the cos ends, (12-base, complimentary, single-stranded overhangs at the end of each molecule) may re-anneal during digestion. This can give the appearance that digestion is incomplete. To avoid this problem, heat the DNA at 65°C for 5 minutes prior to electrophoresis to melt ends that have annealed.

Plasmid DNA: Circular, supercoiled plasmid DNA typically ranges from 3-10kb in size. Compared to linear DNA, plasmids often require more units of restriction enzyme for complete cleavage due to the supe (1) rcoiling (1) or the total number of sites to be digested (see Recognition Site Density). See Digestion of Supercoiled Plasmid DNA for information on the relative units needed for complete cleavage of a typical plasmid vector with common cloning enzymes. If a supercoiled plasmid is first linearized with another restriction enzyme or relaxed with topoisomerase, less enzyme may be needed for digestion.

Genomic DNA: Digestion of genomic DNA can be difficult due to methylation and viscosity. If methylation is a concern, consider using isochizomers with different methylation sensitivities (see Methylation Sensitivity of Isoshizomer/Neoschizomer Pairs). Viscosity can be adjusted by increasing the reaction volume. Genomic DNA often digests more efficiently when it is diluted to a minimum concentration of 10µg per 50-200µl. If this is not possible, heating the DNA at 65 º C for ten minutes prior to the addition of the restriction enzyme can enhance activity (3) . Addition of spermidine to final concentration of 1-5mM also has been reported to increase enzyme activity in the digestion of genomic DNA (4) . Addition of BSA to restriction digests at a final concentration of 0.1mg/ml may also improve enzyme activity.

PCR Products: PCR-amplified DNA may be digested with restriction enzymes that have recognition sequences within the amplified sequence or in the primer regions. The number of enzyme units needed must be balanced with the total number of sites to assure complete cleavage. Longer incubation times may be required to ensure complete digestion. Enzymes with low overdigestion values (<12 units/16 hours) should be avoided in overnight digestions, as star activity or trace contaminants present in these enzymes may lead to problems. Consult the Promega Product Information sheet for the overdigestion value of the enzyme. For many common restriction enzymes, acceptable activity is seen in PCR buffer, although digestion after amplification may not result in the expected compatible ends due to residual polymerase activity (5) . Digestion near the end of a PCR product may also present problems. Restriction enzymes require varying amounts of flanking DNA around the recognition site, usually 1-3 bases but occasionally more (See Digestion of Sites Close to the End of Linear DNA). If an oligonucleotide primer is designed with a cut site that is too close to the end of the DNA, the site may cut poorly or not at all. Since it is very difficult to assay for cutting near the end of DNA, the effectiveness of compensation with extra enzyme units or increased incubation time is difficult to determine. Use of proofreading enzymes in PCR may also complicate the situation as these enzymes are capable of degrading the 3´ ends of amplimers, interfering with complete digestion by restriction enzymes. The use of high dNTP concentrations and immediate cooling to 4°C after PCR will reduce such degradation. Another reason for incomplete digestion of PCR fragments may be primer dimers. If the restriction site is built into the primer, primer dimers will contain a double-stranded version of the site, usually in vast molar excess over that of the desired target PCR fragment. This problem can be easily avoided by purifying the PCR fragment prior to restriction enzyme digestion using the Wizard® PCR Preps DNA Purification System (Cat.# A7170).

Double-Stranded Oligonucleotides: Many of the same considerations for PCR products apply to the digestion of double-stranded oligonucleotides. In this case high densities of recognition sites per unit of mass can be present and the site may also be near the end of the DNA molecule. Again, longer digestion times and/or more enzyme may be needed. Enzymes with a low overdigestion specification (12 units/16 hours) should be avoided in overnight digestions.

Single-Stranded DNA: Cleavage of single-stranded DNA, although at a greatly reduced rate compared with double-stranded DNA, has been reported for a few restriction enzymes (6) . Studies have shown, however, that several restriction enzymes that appear to cleave single-stranded DNA actually recognize folded-back duplex regions within the single-stranded genomes (e.g., M13, f1, single-stranded phiX174) (7) (8) . Therefore, these enzymes are not digesting single-stranded DNA, rather individual sites that are in the duplex form.

DNA-RNA Hybrids: Digestion of DNA-RNA hybrid molecules has been described for several restriction enzymes (AluI, EcoRI, HaeIII, HhaI, HindIII, MspI, SalI, ThaI) (9) . In these cases, the DNA strand of the hybrid was digested in the identical place as duplex DNA. Digestion required 20 to 50-fold higher enzyme levels than those needed for duplex DNA. It is possible but not proven that the RNA was also cleaved with large excesses of enzyme.

Influence of Flanking Sequence: The sequences flanking the restriction enzyme recognition sequence can influence the cleavage rate of many restriction enzymes although the differences are usually less than 10-fold. A small number of enzymes (e.g., NaeI, HpaII, SacII, NarI, EcoRII) exhibit more pronounced site preferences and are designated Type IIe. See Site Preferences and Turbo&trade Restriction Enzymes for further information.

Methylation: Methylation of nucleotides within restriction enzyme recognition sequences can affect digestion. Methylation may occur as 4-methylcytosine, 5-methylcytosine, 5-hydroxymethylcytosine or 6-methyladenine in DNA from bacteria (including plasmids), eukaryotes and their viruses. The sensitivity, or lack thereof, to site-specific methylation, is known for many restriction enzymes (10) . Often, isoschizomers differ in their methylation sensitivity. Refer to Cat.# A1330) provide an easy and effective way to isolate and purify DNA, free of salt or macromolecular contaminants. The addition of spermidine to a final concentration of 1mM and/or BSA to a final concentration of 0.1mg/ml can also improve digestion of poor quality miniprep DNA.

Genomic DNA: Genomic DNA frequently contains more contaminants than plasmid DNA. Best results are obtained when the absorbance ratios at A260/A280 are at least 1.8. Spermidine can be added to a final concentration of 1mM and/or BSA to a final concentration of 0.1mg/ml to improve digestion of poor quality genomic DNA. For further information see Digestion of High Molecular Weight DNA.

Genomic DNA Embedded in Agarose plugs: Pulsed field gel electrophoresis permits the resolution of extremely large DNA fragments. Genomic DNA purified by traditional techniques can contain double-stranded breaks due to mechanical shear forces. Such breaks can be a source of background in megabase mapping of fragments of 50-1000kb. To avoid this, mammalian, bacterial and yeast cells can be embedded in agarose strips and the cells lysed and treated with proteinase K in situ (11) . Most restriction enzymes can cut DNA embedded in agarose provided that more enzyme and longer incubation times are used. A good rule of thumb is to use 5-10 units of enzyme per microgram of DNA and to avoid using restriction enzymes with low overdigestion values (<20 units/16 hours), which can cause problems during longer incubations with excess enzyme. For further information, refer to Digestion of High Molecular Weight DNA.

Genomic DNA Purified From Blood. The anti-coagulant used during blood collection can affect the ability of restriction enzymes to completely digest DNA. Use EDTA as an anti-coagulant rather than Heparin, which can bind tightly to the enzyme and interfere with digestion. The absorbance ratios at A260/A280 should be at least 1.8, indicating that protein has been removed efficiently. A number of rapid DNA purification protocols have been written that do not require separation of white cells from red cells (12) (13) . These techniques can yield good quality DNA from small volumes of blood, but the DNA obtained after scale-up may be of poorer quality. For larger blood samples, a technique that separates white blood cells from red blood cells, such as pelleting red blood cells through a Ficoll® gradient, is recommended prior to DNA purification.

Promega offers the Wizard® Genomic DNA Purification Kit (Cat.# A1120) for the isolation of genomic DNA from white blood cells (with reagents/protocol for removal of red cells), tissue cultured cells, animal tissue, plant tissue and Gram-positive and Gram-negative bacteria. DNA purified with this system is suitable for digestion with restriction enzymes.

PCR Products: Contaminants in PCR such as salts, glycerol, and primer dimers can inhibit restriction enzyme activity. The Wizard® PCR Preps DNA Purification System (Cat.# A7170) provides a reliable method for purification of double-stranded PCR-amplified DNA from any salts or macromolecular contaminants.

C. Recognition Site Density

Restriction enzyme activity units are usually defined based on a one-hour digest of 1µg of lambda DNA. When digesting other substrates, adjustments may be needed based on the amount of substrate, the number of recognition sites per molecule and the incubation time. The following table illustrates the effect of differences in substrate recognition sites per molecule for EcoR I while keeping the substrate mass and incubation time constant.

Table 2.3. Differences in Substrate Recognition Sites for EcoR I.
DNA Substrate Base
Pairs
Picomoles
in 1µg*
Cut Sites
(EcoRI)
Picomoles
Cut Sites
Units
Needed
Unit definition (lambda) 48,502 0.0317 5 0.1585 1
plasmid 3,000 0.5 1 0.5 3**
PCR fragment 700 2.2 1 2.2 14
oligonucleotide 25 62.5 1 62.5 394

*Based on 650 Daltons per base pair of DNA.
**Enzymes differ in their ability to digest supercoiled vs. linear substrates.

References

  1. Fuchs, R. and Blakesley, R. (1983) Guide to the use of type II restriction endonucleases.Meth. Enzymol.101, 3.
  2. Wells, R., Klein, R. and Singleton, C.K. (1981) In: The Enzymes XIV 157.
  3. Hinds, K., Shamblott, M. and Litman, G. (1991) In: Methods in Nucleic Acid Research, Karam, J., Chao, L. and Warr, G. eds., CRC Press.
  4. Bloch, K. (1987) In: Current Protocols in Molecular Biology, Ausubel, F.M. et al., eds., Green Publishing Associates.
  5. Turbett, G.V. and Sellner, L.N. (1996) Digestion of PCR and RT-PCR products With restriction endonucleases without prior purification or precipitation. Promega Notes60, 23&ndash7.
  6. Yoo, O.J. and Agarwal, K. L. (1980) Cleavage of single strand oligonucleotides and bacteriophage phiX174 DNA by Msp I endonuclease.J. Biol. Chem.255, 10559&ndash62.
  7. Nevendorf, S. and Wells, R. (1980) In: Gene Amplification and Analysis: Restriction Endonucleases. Vol. I, Chirikjian, J., ed., Elsevier, North Holland.
  8. Blakesley, R.W. et al. (1977) Duplex regions in "single-stranded" phiX174 DNA are cleaved by a restriction endonuclease from Haemophilus aegyptius.J. Biol. Chem.252, 7300&ndash6.
  9. Molloy, P.L. and Symons, R.H. (1980) Cleavage of DNA.RNA hybrids by type II restriction enzymes.Nucleic Acids Res.8, 2939.
  10. McClelland, M. et al. (1994) Effect of site-specific modification on restriction endonucleases and DNA modification methyltransferases.Nucleic Acids Res.22, 3640&ndash59.
  11. McClelland, M. et al. (1987) Restriction endonucleases for pulsed field mapping of bacterial genomes.Nucleic Acids Res.15, 5985&ndash6005.
  12. Miller, S.A., Dykes, D.D. and Polesky H.F. (1988) A simple salting out procedure for extracting DNA from human nucleated cells.Nucleic Acids Res.16, 1215.
  13. Grimberg, J. et al. (1989) A simple and efficient non-organic procedure for the isolation of genomic DNA from blood.Nucleic Acids Res.17, 8390.

Restriction Enzyme Cleavage: &lsquosingle-site&rsquo enzymes and &lsquomulti-site&rsquo enzymes

Restriction enzymes are proteins used to fragment and clone DNA, but their biological function is to protect bacteria and archaea against viral infections. All bind to double-stranded (ds) DNA at specific sequences of base pairs (the &lsquorecognition sequence&rsquo) and cleave the DNA strands. Given their catalytic similarities, we might expect all restriction enzymes to be similar to each other, but they are in fact extremely diverse, and vary widely in amino acid sequence, three-dimensional structure, subunit composition, and modes of action. Restriction enzymes of identical specificity (&lsquoisoschizomers&rsquo) are sometimes similar, and represent diverged versions of the same ancestral protein, but those of different specificity are often unique, and display no more similarity to one another than to unrelated proteins chosen at random. It seems likely that restriction enzymes arose independently many times during microbial evolution and under varied circumstances.

Accompanying this diversity are subtle differences in the ways that restriction enzymes behave. In one comparison, seven enzymes that cleave the sequence GGCGCC at four different positions were examined, and five distinct reaction pathways were discerned (1). Perhaps the most important mechanistic difference when using restriction enzymes as molecular biology reagents concerns the number of recognition sites a restriction enzyme must bind to in order to cleave. Most restriction enzymes act as simple monomers (one protein chain, e.g. MspI (NEB #R0106) (2)) or homodimers (two identical protein chains, e.g. BamHI (NEB #R3136)), which bind and cleave one recognition site at a time. These enzymes cut substrates with one site as efficiently as they cut substrates with several sites. Others are more complex, and undergo allosteric activation, or form &lsquotransient&rsquo dimers (e.g. FokI (NEB #R0109) (3-5)), tetramers (e.g. NgoMIV (NEB #R0564) (6)), or even larger assemblages (e.g. BcgI (NEB #R0545) (7,8)), and these cut only when bound to two, and sometimes more (9), sites at once. In some cases, this &lsquomulti-site&rsquo, behavior might be an adaptation against accidental cleavage of the bacterium&rsquos own DNA. Structurally, it likely stems from the subunit organizations of the enzymes and how their recognition and catalytic domains fit together (8). Irrespective of the why and how, the need to bind to more than one site in order to cleave can make substrates with only one site difficult to cut in vitro.

Restriction enzymes that bind several sites in order to cleave exhibit several characteristics:

    Cleavage kinetics. Substrates with single sites are cleaved slowly and in some cases incompletely because enzymes must interact with (&lsquobridge&rsquo) two or more DNA molecules at once. The probability of doing so declines precipitously at low DNA concentrations. Adding more enzyme to try to improve cleavage in this situation can do the opposite and make matters even worse, because increasing enzyme concentration in effect reduces the relative substrate concentration (refer to #2 below). If the contacts between the subunits are fragile, as they are thought to be for transient dimers such as FokI (NEB #R0109) (10), then enzymes bridging sites in trans, in different molecules, can be unstable and ineffective. In contrast, when multiple sites are present in the same DNA molecule, the local concentration of sites is higher, and enzymes bridging sites in cis are more stable, both of which lead to faster, more complete, cleavage. Multi-site enzymes vary in the degree to which they are affected by these and related factors. Some, such as BspMI/BfuAI (NEB #R0502) (11) and NmeAIII (NEB #R0711) barely cleave 1-site substrates at all. Others (e.g. SacII (NEB #R0157) cut partially, and yet others (e.g. PluTI (NEB #R0713)) can cleave to near-completion.

Given the diversity of restriction enzymes, many exceptions occur, but single-site and multi-site enzymes partition fairly well into two distinguishable groups based on positions of cleavage.

    Single-site enzymes. The majority of restriction enzymes that cleave within or very close to their recognition sequence are active at single-sites. These enzymes are classified as &lsquoType IIP&rsquo if their sequences are palindromic (symmetric), and &lsquoType IIT&rsquo if their sequences are asymmetric and two different catalytic sites are used to cleave the DNA strands. They cleave to completion DNA substrates with only one site as efficiently as they cleave substrates with several sites. Their cleavage ability is not inhibited at high enzyme concentration due to site-saturation, and is not enhanced by the addition of specific oligos.

Type IIT enzymes AciI (NEB #R0551) and EarI (NEB #R0528) are possible exceptions to this generalization, as too are several Type IIP enzymes. These enzymes cleave 1-site substrates slowly, and in some cases, incompletely cleavage is inhibited at high enzyme concentrations due to site-saturation and cleavage can be enhanced by the addition of specific oligos. These Type IIP enzyme exceptions include: AluI (NEB #R0137) BsaWI (NEB #R0567) (25) BsrFI/Cfr10I (NEB #R0562) (14,19,20) Ecl18kI (12,18) EcoRII (9,17,19,20) HpaII (NEB #R0171) (19,20) NaeI (NEB #R0190) (13,24,26,27) NarI/Mly113I (NEB #R0191) (1,19,20,24,28) NgoMIV ((NEB #R0564) 6) PluTI/BbeI (NEB #R0713) (1) RsrII (NEB #R0501) SacII/Cfr42I (NEB #R0157) (19,29) Sau3AI (NEB #R0169) (19,20) SfiI (NEB #R0123) (16,30-35) SgrAI (NEB #R0603) (19,20,36-38) SmlI and XmaI/Cfr9I (NEB #R0180) (19,24), all of which act to one degree or another as multi-site enzymes.

RECOMMENDATIONS

If you are using an enzyme that may require more than one recognition site on the substrate to cleave optimally, we suggest two possible optimization methods: 1) Titrate the units of enzyme used in the reaction to determine the optimal enzyme to substrate ratio. As a starting point, we recommend using 1-2 &mul of restriction enzyme (at the supplied units/&mul) per microgram of substrate and performing 2-fold serial dilutions of the enzyme, keeping the DNA concentration constant. 2) If that is not possible, add duplex oligonucleotides that contain the recognition site. The oligos provide the additional recognition site needed to activate substrate-bound, but dormant enzyme monomers. Addition of duplex DNA containing a recognition site can compete for binding and reduce the effective enzyme concentration. To use oligos effectively, the stoichiometry of the reaction needs to be established beforehand by performing a series of titrations and identifying the optimum range for the concentration of oligos. We recommend keeping the enzyme concentration constant at 2-4 fold above the optimum established in step 1, above, while performing 2-fold serial dilutions of the oligo. As a starting point, we recommend a ratio of 4:1 (oligo sites:substrate sites) and performing a 2-fold serial dilution of the oligo, keeping the enzyme and substrate concentrations constant.


Watch the video: Κάνναβη - Το χορταράκι του Θεού (December 2021).