Information

What is intracellular retention?


On the wiki page for proto-cadherins, they write, "The cytoplasmic domain also mediates intracellular retention, a property which distinguishes the clustered protocadherins from the related classical cadherins." citing the following source.

Unfortunately, I was unable to find much anything to go off. Anyone know off-hand what this terminology is referencing?


Based on this line from the paper you linked, it seems like they are using intracellular retention to refer to proto-cadherins being taken up in to the cell via endocytosis.

It is possible that the effects of deleting the intracellular domain might be a result of loss of an organelle retention signal located in the cytoplasmic domain of the protein and/or a decrease in endocytosis of the protein accumulated in the membrane.

This paper also refers to intracellular retention of cadherins in the context of endocytosis of proto-cadherins: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3216661/

Based on this information, the quote from the Wikipedia page ("The cytoplasmic domain also mediates intracellular retention, a property which distinguishes the clustered protocadherins from the related classical cadherins.") seems to be saying that the cytoplasmic domain regulates proto-cadherins on the cell membrane being taken back up into the cell via endocytosis, hence retaining them intracellularly.


Intracellular retention of glycosylphosphatidyl inositol-linked proteins in caveolin-deficient cells

The relationship between glycosylphosphatidyl inositol (GPI)-linked proteins and caveolins remains controversial. Here, we derived fibroblasts from Cav-1 null mouse embryos to study the behavior of GPI-linked proteins in the absence of caveolins. These cells lack morphological caveolae, do not express caveolin-1, and show a ∼95% down-regulation in caveolin-2 expression these cells also do not express caveolin-3, a muscle-specific caveolin family member. As such, these caveolin-deficient cells represent an ideal tool to study the role of caveolins in GPI-linked protein sorting. We show that in Cav-1 null cells GPI-linked proteins are preferentially retained in an intracellular compartment that we identify as the Golgi complex. This intracellular pool of GPI-linked proteins is not degraded and remains associated with intracellular lipid rafts as judged by its Triton insolubility. In contrast, GPI-linked proteins are transported to the plasma membrane in wild-type cells, as expected. Furthermore, recombinant expression of caveolin-1 or caveolin-3, but not caveolin-2, in Cav-1 null cells complements this phenotype and restores the cell surface expression of GPI-linked proteins. This is perhaps surprising, as GPI-linked proteins are confined to the exoplasmic leaflet of the membrane, while caveolins are cytoplasmically oriented membrane proteins. As caveolin-1 normally undergoes palmitoylation on three cysteine residues (133, 143, and 156), we speculated that palmitoylation might mechanistically couple caveolin-1 to GPI-linked proteins. In support of this hypothesis, we show that palmitoylation of caveolin-1 on residues 143 and 156, but not residue 133, is required to restore cell surface expression of GPI-linked proteins in this complementation assay. We also show that another lipid raft-associated protein, c-Src, is retained intracellularly in Cav-1 null cells. Thus, Golgi-associated caveolins and caveola-like vesicles could represent part of the transport machinery that is necessary for efficiently moving lipid rafts and their associated proteins from the trans-Golgi to the plasma membrane. In further support of these findings, GPI-linked proteins were also retained intracellularly in tissue samples derived from Cav-1 null mice (i.e., lung endothelial and renal epithelial cells) and Cav-3 null mice (skeletal muscle fibers).


Related Testing

An arterial blood gas is a laboratory test used for the measurement of arterial pH, the arterial partial pressure of oxygen (PaO2), the arterial partial pressure of carbon dioxide (PaCO2), bicarbonate (HCO3), base excess, total CO2, and O2 saturation.

A venous blood gas is a laboratory test identical to an arterial blood gas measurement, except the blood is drawn from a venous site. This results in a slightly more acidic “normal” pH range.

Urine chloride is a direct measurement of chloride being excreted into urine. This test is useful to help determine the etiology of metabolic alkalosis.[3][4][5]


MATERIALS AND METHODS

Cell Culture and Electroporation

3T3-L1 fibroblasts were differentiated and electroporated as described previously (Zeigerer et al., 2002). Studies were performed 1 d after electroporation. For small interfering RNA (siRNA) experiments, 2 nmol of siRNA was added in each electroporation cuvette, and experiments were done 2 d after electroporation. AS160 knockdown adipocytes are 3T3-L1 in which AS160 was knocked down by 70–90% by using retroviral transfer of AS160-specific short hairpin RNA (shRNA) (Eguez et al., 2005). 3T3-L1 cells stably expressing HA-GLUT4 have been described previously (Martin et al., 2006).

Plasmids, siRNAs, Ligands, and Antibodies

Creation of the FA, LA, and FY HA-GLUT4-green fluorescent protein (GFP) mutants have been described previously (Blot and McGraw, 2006). Alanine substitutions for the glutamic acids of the TELEY motif and the various double mutants were created using Stratagene (La Jolla, CA) QuikChange mutagenesis kit. The mutations were verified by sequencing (Cornell DNA sequencing facility, BioResource Center, Ithaca, NY). pCMV transferrin receptor (TR) and pCMV IRAP-TR containing cDNA coding for the human TR and a fusion protein between the intracellular and transmembrane domains of TR fused the cytosolic tail of IRAP, respectively, have been described previously (Johnson et al., 1998). The Stealth siRNAs used were from Invitrogen (Carlsbad, CA): control (Ctrl) (GAGCUACGAGCAACAUUUCGGAUCA), μ1A371 (GAGAGCAUCCGAGACAACUUUGUCA), μ1A585 (UCCUGGAUGUCAUUGAGGCUGUUAA), and γ-adaptin (AGAUCUUUCAGACAGUCCACAAUUG).

The HA.11 anti-hemagglutinin (HA) epitope mouse monoclonal antibody (mAb) (Covance, Berkley, CA) and horseradish peroxidase (HRP)-conjugated human transferrin were prepared as described previously (Karylowski et al., 2004). Fluorescent secondary antibodies were purchased from Jackson ImmunoResearch Laboratories (West Grove, PA). Mouse anti γ-adaptin was from Transduction Laboratories (BD Biosciences, San Jose, CA), and rabbit anti-μ1A serum was a kind gift from Dr. Rodriguez-Boulan (Weill Cornell Medical College, New York).

Data Acquisition and Processing

Images were collected on a DMIRB inverted Leica microscope (Leica Microsystems, Deerfield, IL) by using a 40 × 1.25 numerical aperture oil-immersion objective. The microscope was coupled to a charge-coupled device 12-bit camera (Princeton Instruments, West Chester, PA). Exposure times for each fluorescence channel were chosen such that >95% of the image pixel intensities were below camera saturation and the exposure times for each fluorophore were kept constant within each experiment. Fluorescence quantifications were done using MetaMorph image processing software (Molecular Devices, Sunnyvale, CA) as described previously (Lampson et al., 2000 Lampson et al., 2001 Zeigerer et al., 2002). Backgrounds were measured on HA-GLUT4-GFP–negative cells and were subtracted from specific signals.

HA-GLUT4-GFP Trafficking Assays

The HA-GLUT4-GFP surface-to-total ratio determination assay was described previously (Lampson et al., 2001). To calculate the percentage of GLUT4 in the plasma membrane, the total HA-GLUT4-GFP was measured by indirect immunofluorescence on saponin-permeabilized adipocytes with HA.11 and in parallel plasma membrane was measured in unpermeabilized cells. The fraction of HA-GLUT4-GFP on the surface is thus (Cy3/GFP)surface/(Cy3/GFP)total. In fibroblasts stably expressing HA-GLUT4, surface HA-GLUT4 was measured by anti-HA staining on intact fixed cells, and total HA-GLUT4 was measured on a separate coverslip by anti-HA staining on saponin-permeabilized fixed cells. The fraction of HA-GLUT4 on the surface is thus (Cy3)surface/(Cy3)total.

The HA-GLUT4-GFP exocytosis assay measures the increase of cell associated HA.11 anti-HA mAb over time (Karylowski et al., 2004). A plot of the cyanine 3 (CY3)/GFP ratio versus incubation times was fit to a single exponential described by the equation: (Cy3/GFP)t = (Cy3/GFP)plateau − (Cy3/GFP)t = 0 × exp(−kext) where (Cy3/GFP)t is the Cy3/GFP ratio measured at time t, (Cy3/GFP)plateau is the Cy3/GFP ratio measured at the plateau, and kex is HA-GLUT4-GFP exocytosis rate constant.

The HA-GLUT4-GFP return to basal levels after insulin withdrawal assay was described in detail previously (Blot and McGraw, 2006).

HA-GLUT4-GFP Fast Recycling Assay

Twenty-four hours after electroporation, the cells are incubated in serum free (DMEM-BB) at 37°C for 2 h. HA.11 antibody (saturating concentration in DMEM-BB supplemented with 1 mg/ml ovalbumin) is pulsed for 5 min at 37°C, and unbound antibody is removed by extensive washes with warm DMEM-BB medium for 1 min. Two coverslips per mutant are immediately transferred onto ice water slurry (time 0 and total pulse) and another coverslip is incubated for 30 min at 37°C in DMEM-BB in the presence of Cy3-goat anti-mouse antibody (GAM). In parallel, cells for time 0 are incubated for 30 min on ice water slurry with a cold solution of Cy3-GAM. At the end of the incubations, cells are washed three times with cold medium II solution and fixed. Cells for total pulse are permeabilized and stained with a saponin containing Cy3-GAM solution. Cells are imaged and GFP and cell-associated Cy3 fluorescence are quantified. The average fraction of pulsed GLUT4 in the cell surface at time 0 is the ratio (Cy3/GFP)t = 0/Cy3/GFP)total and was equal to 15%. The fraction of internalized GLUT4 that recycled to the cell surface after 30 min was ((Cy3/GFP)t = 30/Cy3/GFP)total) − (Cy3/GFP)t = 0/Cy3/GFP)total.

Epitope Ablation Assay

HA-GLUT4-GFP intracellular distribution between TR-containing endosomes and GLUT4 specialized/storage compartments/vesicles (GSVs) is determined by epitope ablation after HRP-mediated 3,3′-diaminobenzidine (DAB) polymerization (Lampson et al., 2001 Zeigerer et al., 2002 Karylowski et al., 2004).


How to find your total body water?

Since it’s so important to keep an eye on your fluid balance, you’ll need to know how you can determine yours. There are two major methods to measure and determine your fluid levels. These are the dilution method and the BIA method.

The dilution method involves drinking a known dose of heavy water (deuterium oxide) and allowing it to distribute around the body. Once the water has had time to settle, the amount of heavy water is compared with the amount of normal water. The proportion will reflect the amount of total body water. To determine ECW, sodium bromide is used instead of heavy water.

The dilution method is recognized as a gold standard for measuring total body water however, these tests would need to be done at a hospital under the guidance of a trained physician. This test takes several hours to complete during which any fluid of any type going in or out of the body has to be carefully recorded.

For these reasons, you’re unlikely to have this test performed unless your doctor needs to know your total body water with absolute certainty because of a serious health complication.

The second, more accessible method to determine body water content is bioelectrical impedance analysis (BIA). For most people who do not have serious medical issues, this method is much more practical than the dilution method.

A small electrical current is applied to the body, and the opposition that current experiences (impedance), is measured. From that impedance result, a BIA device can report your body water percentage. Advanced BIA devices are able to reflect the difference in Intracellular and Extracellular water as well, which can reveal the ICW:ECW balance.


DISCUSSION

This work was intended to analyze in detail the subcellular localization of the mammalian dopamine D2 receptor in several types of heterologous cells. Our initial aim was to detect differential distribution in cell compartments and differential regulation between the two splicing isoforms of the receptor. Indeed, besides their basic function of modulating the activity of heterotrimeric G proteins, the precise subcellular localization of membrane receptors are likely to be major determinants of their physiological role (Valdenaire and Vernier, 1997). The demonstration that the differential splicing of the D2 dopamine receptor is regulated in mammals (Guivarc’h et al., 1995 Guivarc’h et al., 1998) and the existence of a differential localization of the two transcripts in the brain suggested possible differences in the intracellular targeting of this physiologically important receptor.

The observation of a predominantly intracellular distribution of the transfected D2 receptor isoforms was very surprising at first glance and raised many embarrassing questions. The problem is not the strong accumulation of the D2 receptors in the secretory pathway, but mainly the default of membrane localization. Some technical issues certainly accounted for the poor detection of the N-terminal tags when the receptors are localized at the plasma membrane. It does not depend on the antibody itself since this phenomenon occurred either with the 9E10 anti-myc monoclonal antibody (labeling the short isoform of the D2 receptor) or with the P5D4 anti-VSV-G monoclonal antibody (used to detect the long D2 receptor isoform). The reasons for this are not clear, although some kind of interaction between the receptor N-terminus and components of the extracellular matrix may prevent antibodies from good access to the epitopes. The use of different approachs to visualize receptors allowed us to partly solve this issue. The polyclonal anti-D2 receptor antibody, which is directed against the third cytoplasmic loop of the receptor, provided a much better plasma membrane decoration than the monoclonal antibody. The short isoform of the D2 receptor fused to GFP gave essentially the same labeling pattern as that of the anti-D2 receptor antibody, suggesting that they both provided a faithful picture of the subcellular localization of the receptor isoforms.

The main feature of the D2 receptor localization remains that it is predominantly found intracellularly, corresponding to about 75-80% of the translated receptors (Fig. 4). Transient expression of the G-protein-coupled receptors certainly overloads secretory intracellular compartments. However, it does not prevent a large proportion of the receptors from reaching the plasma membrane in the case of the D1 dopamine receptors (Fig. 8) or β-adrenoreceptors (Von Zastrow et al., 1993) or α-receptors (Fonseca et al., 1995 Hirasawa et al., 1997). However, in some instances, a predominant intracellular distribution has been described for a few receptors of the G-protein-coupled receptor superfamily such as the α2C-adrenoreceptor (Daunt et al., 1997), the α1A-adrenoreceptor (Hirasawa et al., 1997), the 5HT1B receptor (Langlois et al., 1996) and the thrombin receptor (Hein et al., 1994). Whether these observations have a common mechanism and whether they correspond to a natural situation is not known yet.

In the case of the D2 receptor, several hypothesis may have accounted for this puzzling observation and some of them have been tested in the present study. First, this phenomenon is not cell-specific since it has been observed in HeLa, COS-7, and HEK-293 cells, as well as in the NG108.15 neuroblastoma-glioma hybrid. Second, it does not depend on a delayed transport to the plasma membrane, as shown by the labeling not being altered with time. Incidentally, it is worth mentioning that the two isoforms showed no significant difference in their presence at the cell surface, thus indicating that the alternative splicing is not affecting the protein targeting to the plasma membrane. By contrast, the longest of the D2 receptor isoforms is more strongly retained in the early secretory membranes, its distribution remaining essentially confined to the ER. The relative blockage of the D2a isoform in the ER was also seen in CHO cells by Fishburn et al., who showed that the long D2a receptor isoform exhibited a glycosylation pattern reminiscent of poorly transported membrane proteins (Fishburn et al., 1995).

Three observations provided clues to explain the intracellular retention of the D2 receptor isoforms. The first one is that a glycosylation defect, due to an imperfect folding of the protein, could theoretically promote a fast retrieval of the receptors from the intermediate compartment of the Golgi complex (Gahmberg and Tolvanen, 1996). In the case of the D2 receptors (Fig. 2), a defect in the maturation of the polysaccharide moities of the receptor appears to be the consequence of impaired transport out of the ER, but not its initial cause, in agreement with previous studies (Fishburn et al., 1995).

The second possibility is that the retention of the receptor in the ER may be dependent, at least in part, on the activation of PTX-sensitive G proteins by constitutively active D2 receptors. The existence of a significant intrinsic activity of the D2 receptors was first suggested by Hall and Strange (Hall and Strange, 1997). This hypothesis is supported by data showing that activation of PTX-sensitive-heterotrimeric G proteins was able to block the formation of secretory vesicles from the TGN (Leyte et al., 1992). A similar mechanism may have accounted for the impaired transport of the long isoform of the D2 receptor early in the secretory pathway. This contention is further supported by the fact that this receptor localization is insensitive to BFA, suggesting that the immature receptors are retained in a membrane compartment that could be excluded from the Golgi bi-directional traffic. In addition, the transport of receptors otherwise normally present at the cell surface (such as the D1 dopamine receptor), is also impaired by the simultaneous presence of the D2 receptor (Fig. 8). This indicates that the modification of the membrane protein traffic induced by the D2 receptor is more general and that it affects at least one other polytopic transmembrane protein. Whether this phenomenon may be elicited by other G-protein-coupled receptors retained intracellularly is not known. However, in the case of GABAB R1 subunit which, alone, is both unable to go to the plasma membrane and unable to activate G proteins, no perturbation of the ER or other membrane compartments are elicited (Couve et al., 1998).

A third possibility suggested by a recent study (Vickery and von Zastrow, 1999) that provides evidence for a constitutive endocytosis of the D2 receptor in a dynamin-independent, clathrin-independent pathway, as analyzed by the endocytosis of antibodies directed against N-terminal tagged receptor. Our data do not exclude this possibility and two of the observations made by these authors fit with our own data: (1) that constitutive endocytosis is very likely to correspond to a constitutive activation of the receptor and (2) an accumulation of the D2 receptors inside the cells is also observed in these experiments. However, in the steady-state conditions we used, most of this intracellular accumulation predominantly corresponded to a blocked transport in the biosynthetic pathway (as supported by tunicamycin treatment) and not to constitutive endocytosis.

From a different perspective, the poor localization of the D2 receptors at the plasma membrane may rely on the lack of a component, a molecular partner that would be required for the maintenance of the receptor at the plasma membrane in the transfected cells. In particular, heterologous receptor dimerization should be a requirement for a proper targeting to the plasma membrane, as recently shown for the GABAB and GABAC receptor subtypes (Kaupmann et al., 1998 White et al., 1998). Although the possibility of self-dimerization of the D2 receptor has been reported by some authors (Ng et al., 1996), no evidence exists for the association of the D2 receptor with another type of G-protein-coupled receptor or even for an association between the two D2 receptor isoforms (this study). In addition, the requirement of some type of ‘scaffolding proteins’ may be envisaged, such as PDZ-domain proteins, but no consensus for PDZ binding is found for the D2 receptor.

Although the previous hypothesis may account for the unusual localization of the D2 receptors after transient expression in cells, the provocative observation of a massive vacuolization of the ER is related, at least in part, to receptor-dependent activation of heterotrimeric G proteins. The salutatory effect of PTX, based on the ER morphology analysis, implies that G protein activation has been elicited by the endogenous activity of the D2 receptors. The mechanism of PTX inhibition of G protein stimulation relies on the impairment of the direct interaction of the receptor with the C-terminus of the α subunit of the G protein which is ADP ribosylated by the toxin. The phenomenon strongly resembles that promoted by the pore-forming toxin aerolysin (Abrami et al., 1998). Although the mechanisms of vacuolization promoted by aerolysin are not completely understood, the toxin affects early steps of protein secretion, as did the dopamine D2 receptors. In addition, it involves pertussis-toxin sensitive G proteins and certainly calcium release from internal stores (Krause et al., 1998). In this respect, the D2 receptor, which can also modulate calcium entry via G protein activation (Lledo et al., 1994), may be similar to this pore forming toxin.

The observation of the intracellular localization of the D2 receptor isoforms raised the question of its physiological relevance. In this respect, a predominant intracellular localization of the D2a isoform has been described in the striatum (Khan et al., 1998), and can also be seen in the paper by Hersch et al. (Hersch et al., 1995) or Delle Donne et al. (Delle Donne et al., 1997). Therefore the regulation of the mRNA splicing of the D2 receptor which has been observed in several physiological situations (Guivarc’h et al., 1995 Guivarc’h et al., 1998) may result in a differential localization of the isoforms in intracellular compartments. Whether it promotes solely a modification of the receptor trafficking or also differential interactions with unknown regulatory components of receptor activity will now need to be carefully investigated.

What could the effect of an intracellular receptor be? In addition to heterotrimeric G proteins, important components of intracellular signalling pathways such as adenylyl cyclase are present in the ER and the Golgi apparatus (Yamamoto et al., 1998). Thus, it is plausible that receptors play a role in the intracellular compartments. In addition, modulation of adenylyl cyclase is only part of the potential effects of the D2 receptors in cells. For example, interaction of D2 receptors with heterotrimeric G proteins in the ER and the Golgi may be a regulation factor of the secretion of cell products (Takizawa et al., 1993). In this respect, the D2 receptor is a well known inhibitor of the secretion of peptidic hormones such as prolactin or GH in the pituitary (Missale et al., 1998). Whether activation of the D2 receptor can block not only depolarization and calcium-dependant hormone release but also other steps of transmitter secretion would be an attractive hypothesis to test.

Immunodetection of the epitope-tagged D2 receptor isoforms in transfected COS-7 and HeLa cell lines. COS-7 cells (A,B) and HeLa cells (C,D), have been transfected by either D2b, revealed by the monoclonal 9E10 anti-myc antibody coupled to Texas-Red (A,C), or D2a, revealed by the monoclonal P5D4 anti VSV-G antibody coupled to Texas-Red (B,D). These confocal microscope images reveal the large predominance of intracellular labeling detected with these antibodies. Bar, 2.5 μm.

Immunodetection of the epitope-tagged D2 receptor isoforms in transfected COS-7 and HeLa cell lines. COS-7 cells (A,B) and HeLa cells (C,D), have been transfected by either D2b, revealed by the monoclonal 9E10 anti-myc antibody coupled to Texas-Red (A,C), or D2a, revealed by the monoclonal P5D4 anti VSV-G antibody coupled to Texas-Red (B,D). These confocal microscope images reveal the large predominance of intracellular labeling detected with these antibodies. Bar, 2.5 μm.

Effect of tunicamycin on the labeling and the transport of the D2 receptors to the plasma membrane. COS-7 cells transfected by the myc-tagged D2b receptor were treated with tunicamycin for 12 hours at 10 ng/ml (B) and 20 ng/ml (C), and compared with control cells (A). The receptors were visualized with the monoclonal 9E10 antibody, coupled to Texas-Red. Note the massive restriction of the receptor localization close to the nuclear membrane with increasing doses of tunicamycin compared with control cells. Bar, 3 μm.

Effect of tunicamycin on the labeling and the transport of the D2 receptors to the plasma membrane. COS-7 cells transfected by the myc-tagged D2b receptor were treated with tunicamycin for 12 hours at 10 ng/ml (B) and 20 ng/ml (C), and compared with control cells (A). The receptors were visualized with the monoclonal 9E10 antibody, coupled to Texas-Red. Note the massive restriction of the receptor localization close to the nuclear membrane with increasing doses of tunicamycin compared with control cells. Bar, 3 μm.

Comparison of the distribution of the D2b receptor revealed by anti epitope-tag antibody and GFP-tagged fusion in transiently transfected COS-7 cells. The labeling exhibited by the D2b receptor fused to the GFP is seen both intracellularly and at the plasma membrane (A,B) and is very similar to that obtained with anti-D2 receptor polyclonal antibody, coupled to Texas-Red (C). In sharp contrast, the D2b receptor-GFP construct (B) provides a visualization significantly different from that obtained with the monoclonal 9E10 antibody, coupled to Texas-Red (D), which revealed mainly intracellular compartments. Confocal microscope images bars, 1 μm.

Comparison of the distribution of the D2b receptor revealed by anti epitope-tag antibody and GFP-tagged fusion in transiently transfected COS-7 cells. The labeling exhibited by the D2b receptor fused to the GFP is seen both intracellularly and at the plasma membrane (A,B) and is very similar to that obtained with anti-D2 receptor polyclonal antibody, coupled to Texas-Red (C). In sharp contrast, the D2b receptor-GFP construct (B) provides a visualization significantly different from that obtained with the monoclonal 9E10 antibody, coupled to Texas-Red (D), which revealed mainly intracellular compartments. Confocal microscope images bars, 1 μm.

Relative quantification of the proportion of the D2 receptor isoforms located at the plasma membrane. After membrane biotinylation (see Materials and Methods), the COS-7 cells transfected by either D2a or D2b receptors were lysed and the whole cell lysate was fractionated by centrifugation to provide a nuclear pellet (N nuclei and cell debris) and a post-nuclear supernatant. This supernatant was submitted to streptavidine chromatography to separate biotinylated membranes from nonbiotinylated membranes. In the three fractions, the amount of D2a (grey bars) and D2b (empty bars) receptors were quantified by [ 3 H]-spiperone binding (A) and compared with the total activity of alkaline phosphatase, a marker of plasma and nuclear membrane (B). The histograms correspond to values ± s.e.m (n=3).

Relative quantification of the proportion of the D2 receptor isoforms located at the plasma membrane. After membrane biotinylation (see Materials and Methods), the COS-7 cells transfected by either D2a or D2b receptors were lysed and the whole cell lysate was fractionated by centrifugation to provide a nuclear pellet (N nuclei and cell debris) and a post-nuclear supernatant. This supernatant was submitted to streptavidine chromatography to separate biotinylated membranes from nonbiotinylated membranes. In the three fractions, the amount of D2a (grey bars) and D2b (empty bars) receptors were quantified by [ 3 H]-spiperone binding (A) and compared with the total activity of alkaline phosphatase, a marker of plasma and nuclear membrane (B). The histograms correspond to values ± s.e.m (n=3).

The D2 receptor isoforms are not found in the transferrin endocytosis-pathway. The intracellular labeling obtained with rhodamine-labeled transferrin either after 10 minutes (C) or 60 minutes (F) incubation at 37°C does not match that of the tagged-D2b receptor revealed by the monoclonal 9E10 antibody coupled to FITC (A,D) at the same incubation time. Superimposition of confocal images of the transferrin and D2 receptor labeling (B,E) clearly shows that the two types of labeling are mutually exclusive. Confocal microscope images bar, 2 μm.

The D2 receptor isoforms are not found in the transferrin endocytosis-pathway. The intracellular labeling obtained with rhodamine-labeled transferrin either after 10 minutes (C) or 60 minutes (F) incubation at 37°C does not match that of the tagged-D2b receptor revealed by the monoclonal 9E10 antibody coupled to FITC (A,D) at the same incubation time. Superimposition of confocal images of the transferrin and D2 receptor labeling (B,E) clearly shows that the two types of labeling are mutually exclusive. Confocal microscope images bar, 2 μm.

The D2 receptor isoforms are poorly co-localized with Rab6, a marker of the Golgi complex, in COS-7 and HeLa cells. As analyzed with a confocal microscope, the labeling for the D2a isoform obtained with the monoclonal P5D4 antibody, coupled to FITC, in HeLa cells (A) and with the monoclonal 9E10 antibody, coupled to FITC, for the D2b isoform (C), overlap only for a very small part with that obtained with an anti-rab6 polyclonal antibody, coupled to Texas-Red, (B,D). The D2a receptor transfected in COS-7 cells displays essentially the same pictures (E,F). This receptor labeling is not significantly modified by cell treatment with BFA (10 μg/ml) for 1 hour (G), whereas that of Rab6 spreads over the cytoplasm (H). Bar, 2.5 μm.

The D2 receptor isoforms are poorly co-localized with Rab6, a marker of the Golgi complex, in COS-7 and HeLa cells. As analyzed with a confocal microscope, the labeling for the D2a isoform obtained with the monoclonal P5D4 antibody, coupled to FITC, in HeLa cells (A) and with the monoclonal 9E10 antibody, coupled to FITC, for the D2b isoform (C), overlap only for a very small part with that obtained with an anti-rab6 polyclonal antibody, coupled to Texas-Red, (B,D). The D2a receptor transfected in COS-7 cells displays essentially the same pictures (E,F). This receptor labeling is not significantly modified by cell treatment with BFA (10 μg/ml) for 1 hour (G), whereas that of Rab6 spreads over the cytoplasm (H). Bar, 2.5 μm.


Glossary of biology

This glossary of biology terms is a list of definitions of fundamental terms and concepts used in biology, the study of life and of living organisms. It is intended as introductory material for novices for more specific and technical definitions from sub-disciplines and related fields, see Glossary of genetics, Glossary of evolutionary biology, Glossary of ecology, and Glossary of scientific naming, or any of the organism-specific glossaries in Category:Glossaries of biology.

Any member of a diverse polyphyletic group of photosynthetic , eukaryotic , mostly aquatic organisms ranging from simple unicellular microalgae to massive colonial or multicellular forms such as kelp. Algae may reproduce sexually or asexually , and are often compared to plants , though they lack most of the complex cell and tissue types that characterize true plants. A form of speciation which occurs when biological populations of the same species become isolated from each other to an extent that prevents or interferes with genetic interchange. A class of organic compounds containing an amine group and a carboxylic acid group which function as the fundamental building blocks of proteins and play important roles in many other biochemical processes. An organism which produces an egg composed of a shell and membranes that creates a protected environment in which the embryo can develop outside of water. A set of morphological structures in different organisms which have similar form or function but were not present in the organisms' last common ancestor . The cladistic term for the same phenomenon is homoplasy. The branch of biology that studies the structure and morphology of living organisms and their various parts. Any member of a clade of multicellular eukaryotic organisms belonging to the biological kingdom Animalia. With few exceptions, animals consume organic material , breathe oxygen , are able to move , reproduce sexually , and grow from a blastula during embryonic development. An estimated 7 million distinct animal species currently exist.

Also called an antibacterial.

A type of antimicrobial drug used in the treatment and prevention of bacterial infections . A highly regulated form of programmed cell death that occurs in multicellular organisms. The scientific study of spiders, scorpions, pseudoscorpions, and harvestmen, collectively called arachnids.

Also called selective breeding.

The process by which humans use animal breeding and plant breeding to selectively control the development of particular phenotypic traits in organisms by choosing which individual organisms will reproduce and create offspring . While the deliberate exploitation of knowledge about genetics and reproductive biology in the hope of producing desirable characteristics is widely practiced in agriculture and experimental biology, artificial selection may also be unintentional and may produce unintended (desirable or undesirable) results. A type of reproduction involving a single parent that results in offspring that are genetically identical to the parent. The branch of biology concerned with the effects of outer space on living organisms and the search for extraterrestrial life. The system of immune responses of an organism directed against its own healthy cells and tissues.

Sometimes used interchangeably with primary producer .

An organism capable of producing complex organic compounds from simple substances present in its surroundings, generally by using energy from sunlight (as in photosynthesis ) or from inorganic chemical reactions (as in chemosynthesis ). Autotrophs do not need to consume another living organism in order to obtain energy or organic carbon, as opposed to heterotrophs .

Also called the biosynthetic phase, light-independent reactions, dark reactions, or photosynthetic carbon reduction (PCR) cycle.

A series of chemical reactions which occurs as one of two primary phases of photosynthesis , specifically the phase in which carbon dioxide and other compounds are converted into simple carbohydrates such as glucose. These reactions occur in the stroma, the fluid-filled area of the chloroplast outside the thylakoid membranes. In the Calvin cycle, the products of previous light-dependent reactions ( ATP and NADPH ) undergo further reactions which do not require the presence of light and which can be broadly divided into three stages: carbon fixation , reduction reactions, and ribulose 1,5-bisphosphate (RuBP) regeneration. [1]

Also called carbon assimilation.

The process by which inorganic carbon, particularly in the form of carbon dioxide, is converted to organic compounds by living organisms. Examples include photosynthesis and chemosynthesis . Any member of two classes of chemical compounds derived from carbonic acid or carbon dioxide. One of a class of organic pigments produced by algae and plants , as well as certain bacteria and fungi . An enzyme found in nearly all living organisms exposed to oxygen, including bacteria , plants , and animals . The basic structural and functional unit of all living organisms , and the smallest functional unit of life . A cell may exist as an independent, self-replicating unit (as in the case of unicellular organisms ), or in cooperation with other cells, each of which may be specialized for carrying out particular functions within a larger multicellular organism . Cells consist of cytoplasm enclosed within a cell membrane and sometimes a cell wall , and serve the fundamental purpose of separating the controlled environment in which biochemical processes take place from the outside world. Most cells are visible only under a microscope.

Also called cytology.

The branch of biology that studies the structure and function of living cells , including their physiological properties, metabolic processes, chemical composition, life cycle , the organelles they contain, and their interactions with their environment. This is done at both microscopic and molecular levels. The ordered series of events which take place in a cell leading to duplication of its genetic material and ultimately the division of the cytoplasm and organelles to produce two or more daughter cells. These events can be broadly divided into phases of growth and division, each of which can vary in duration and complexity depending on the tissue or organism to which the cell belongs. Cell cycles are essential processes in all unicellular and multicellular organisms. Any process by which a parent cell divides into two or more daughter cells. Examples include binary fission , mitosis , and meiosis . The semipermeable membrane surrounding the cytoplasm of a cell . The "control room" for the cell . The nucleus gives out all the orders. Grown in the cell's center, it fuses with the parental plasma membrane, creating a new cell wall that enables cell division . The theory that all living things are made up of cells . A tough, often rigid structural barrier surrounding certain types of cells (such as in fungi , plants , and most prokaryotes ) that is immediately external to the cell membrane . Of or relating to a cell . A framework for understanding the movement of genetic information between information-carrying biopolymers within biological systems. Popularly (though simplistically) stated as " DNA makes RNA and RNA makes protein ", the principle attempts to capture the notion that the transfer of genetic information only naturally occurs between certain classes of molecules and in certain directions. A cylindrical cell structure found in most eukaryotic cells, composed mainly of a protein called tubulin. An organelle that is the primary site at which microtubules are organized. They occur only in plant and animal cells and help to regulate cell division . A chemical substance consisting of two or more different chemically bonded elements, with a fixed ratio determining the composition. The ratio of each element is usually expressed by a chemical formula. The state in which both reactants and products are present in concentrations which have no further tendency to change with time in a chemical reaction. A process that leads to the transformation of one set of chemical substances to another. A branch of the physical sciences that studies the composition, structure, properties, and change of matter. Chemical interactions underlie all biological processes. Any of several photosynthetic pigments found in cyanobacteria, algae , or plants . A type of highly specialized organelle in the cells of plants and algae , the main role of which is to conduct photosynthesis , by which the photosynthetic pigment chlorophyll captures the energy from sunlight and converts and stores it in the molecules ATP and NADPH while freeing oxygen from water. A type of lipid molecule that is biosynthesized by all animal cells because it is an essential structural component of animal cell membranes , essential for maintaining both membrane structural integrity and fluidity. A threadlike strand of DNA in the cell nucleus that carries the genes in a linear order.

Also called the Krebs cycle and tricarboxylic acid cycle (TCA).

A series of chemical reactions used by all aerobic organisms to generate energy through the oxidation of acetyl-CoA derived from carbohydrates , fats , and proteins into carbon dioxide and chemical energy in the form of guanosine triphosphate (GTP). In addition, the cycle provides the chemical precursors for certain amino acids as well as the reducing agent NADH that is used in numerous other biochemical reactions. Its central importance to many biochemical pathways suggests that it was one of the earliest established components of cellular metabolism and may have originated abiogenically. A scientific theory in immunology that explains the functions of cells (lymphocytes) of the immune system in response to specific antigens invading the body. The theory has become the widely accepted model for how the immune system responds to infection and how certain types of B and T lymphocytes are selected for destruction of specific antigens. [2] The process of producing individual organisms or molecules with identical or virtually identical DNA , either naturally or artificially. Many organisms, such as bacteria , insects, and plants , are capable of naturally producing clones through asexual reproduction . In biotechnology , cloning refers to the artificial creation of copies of cells, DNA fragments, or other biomolecules by various laboratory techniques. In the context of virus capsid, may refer colloquially to the defined geometric structure of a capsid, or the membrane of an endosome containing an intact virion. The coat of a virus is used in descriptions for the general public. Related slang: uncoating. The use of comparative methods to study the similarities and differences between two or more biological organisms (e.g. two organisms from the same time period but different taxa , or two organisms from the same taxon but different times in evolutionary history). The side-by-side comparison of morphological or molecular characteristics of different organisms is the basis from which biologists infer the organisms' genetic relatedness and their natural histories. It is a fundamental tool in many biological disciplines, including anatomy, physiology, paleontology , and phylogenetics . The scientific study of nature and of Earth's biodiversity with the aim of protecting species , their habitats , and ecosystems from excessive rates of extinction and the erosion of biotic interactions. An evolutionary process by which species of different lineages independently develop similar characteristics, often to the point that the species appear to be more closely related than they actually are. The crossover of some property, usually heat or some component, between two fluids flowing in opposite directions to each other. The phenomenon occurs naturally but is also frequently mimicked in industry and engineering. A fold in the inner membrane of a mitochondrion . The branch of biology that studies the effects of low temperatures on living things within Earth's cryosphere or in laboratory experiments. See cell biology . All of the material within a cell and enclosed by the cell membrane , except for the nucleus . The cytoplasm consists mainly of water, the gel-like cytosol, various organelles , and free-floating granules of nutrients and other biomolecules . One of the four main nitrogenous bases found in both DNA and RNA , along with adenine , guanine , thymine , and uracil (in RNA) it is a pyrimidine derivative, with a heterocyclic aromatic ring and two substituents attached (an amine group at position 4 and a keto group at position 2). A complex, dynamic network of interlinking protein filaments that extends from the cell nucleus to the cell membrane and which is present in the cytoplasm of all cells , including bacteria and archaea . [3] The cytoskeletal systems of different organisms are composed of similar proteins. In eukaryotes, the cytoskeletal matrix is a dynamic structure composed of three main proteins, which are capable of rapid growth or disassembly dependent on the cell's requirements. [4]

Also called the macula adhaerens.

A cell structure specialized for cell-to-cell adhesion. The branch of biology that studies the processes by which living organisms grow and develop over time. The field may also encompass the study of reproduction , regeneration , metamorphosis , and the growth and differentiation of stem cells in mature tissues. Any particular abnormal condition that negatively affects the structure or function of all or part of a living organism and that is not the result of any immediate external injury. Diseases are medical conditions that are often identifiable by specific signs and symptoms. They may be caused by external factors such as infectious pathogens or by internal dysfunctions such as immune deficiency or senescence . See deoxyribonucleic acid . The chemical duplication or copying of a DNA molecule the process of producing two identical copies from one original DNA molecule, in which the double helix is unwound and each strand acts as a template for the next strand. Complementary nucleotide bases are matched to synthesize the new partner strands. The process of determining the precise order of nucleotides within a DNA molecule. Any substance that causes a change in an organism's physiology or psychology when consumed. Drugs may be naturally occurring or artificially produced, and consumption may occur in a number of different ways. Drugs are typically distinguished from substances that provide nutritional support such as food. The existence of a morphological distinction between organisms of the same species , such that individuals of that species occur in one of two distinct forms which differ in one or more characteristics, such as colour, size, shape, or any other phenotypic trait. Dimorphism based on sex – e.g. male vs. female – is common in sexually reproducing organisms such as plants and animals. A motor protein in cells which converts the chemical energy contained in ATP into the mechanical energy of movement.

Also called a trophic pyramid, eltonian pyramid, energy pyramid, or sometimes food pyramid.

A graphical representation of the biomass or bio-productivity generated at each trophic level in a given ecosystem . The more or less predictable and orderly set of changes that occurs in the composition or structure of an ecological community over time. The scientific analysis and study of interactions between organisms and their environment . It is an interdisciplinary field that combines concepts from biology, geography, and Earth science. A biological discipline that studies the adaptation of an organism's physiology to environmental conditions. A community of living organisms in conjunction with the non-living components of their physical environment, interacting as a system.

Sometimes called an ecospecies.

In evolutionary ecology, a genetically distinct geographic variety, population , or race within a species which is adapted to specific environmental conditions. The outermost layer of cells or tissue of an embryo in early development, or the parts derived from this, which include the epidermis, nerve tissue, and nephridia. An organism in which internal physiological sources of heat are of relatively small or quite negligible importance in controlling body temperature compared to ambient sources of heat. Ectotherms generally experience changes in body temperature that closely match changes in the temperature of their environment colloquially, these organisms are often referred to as "cold-blooded". Contrast endotherm . A small molecule that selectively binds to a protein and regulates its biological activity. In this manner, effector molecules act as ligands that can increase or decrease enzyme activity, gene expression, or cell signaling. Conducted or conducting outwards or away from something (for nerves, the central nervous system for blood vessels, the organ supplied). Contrast afferent . The organic vessel containing the zygote in which an animal embryo develops until it can survive on its own, at which point the developing organism emerges from the egg in a process known as hatching. A gradient of electrochemical potential, usually for an ion that can move across a membrane . The gradient consists of two parts: the electrical potential and the difference in chemical concentration across the membrane. Any chemical entity that accepts electrons transferred to it from another chemical entity. It is an oxidizing agent that, by virtue of its accepting electrons, is itself reduced in the process. Contrast electron donor . Any of various molecules that are capable of accepting one or two electrons from one molecule and donating them to another in the process of electron transport . As the electrons are transferred from one electron carrier to another, their energy level decreases, and energy is released. A chemical entity that donates electrons to another chemical entity. It is a reducing agent that, by virtue of its giving up its electrons, is itself oxidized in the process. Contrast electron acceptor . A type of microscope that uses a beam of electrons to create an image of a sample or specimen. Electron microscopes are capable of much higher magnifications and have greater resolving power than conventional light microscopes, allowing them to see much smaller objects in finer detail. The process of oxidative phosphorylation, by which the NADH and succinate generated by the citric acid cycle are oxidized and electrons are transferred sequentially down a long series of proteins , ultimately to the enzyme ATP synthase, which uses the electrical energy to catalyze the synthesis of ATP by the addition of a phosphate group to ADP. The process takes place in the cell's mitochondria and is the primary means of energy generation in most eukaryotic organisms. A developing stage of a multicellular organism . The branch of biology that studies the development of gametes (sex cells), fertilization, and development of embryos and fetuses . Additionally, embryology involves the study of congenital disorders that occur before birth. Any species which is very likely to become extinct in the near future, either worldwide or in a particular area. Such species may be threatened by factors such as habitat loss, hunting, disease, and climate change, and most have a declining population or a very limited range. The ecological state of an organism or species being unique to a defined geographic location, such as an island, nation, country, habitat type, or other defined zone. Organisms are said to be endemic to a place if they are indigenous to it and found nowhere else.

Also called a nonspontaneous reaction or unfavorable reaction.

A type of chemical reaction in which the standard change in free energy is positive, and energy is absorbed. A gland of the animalian endocrine system that secretes hormones directly into the blood rather than through a duct. In humans, the major glands of the endocrine system include the pineal gland, pituitary gland, pancreas, ovaries, testes, thyroid gland, parathyroid gland, hypothalamus, and adrenal glands. The collection of glands that produce hormones which regulate metabolism , growth and development, tissue function, and a wide variety of other biological processes. A form of active transport in which a cell transports molecules such as proteins into the cell's interior by engulfing them in an energy-consuming process. One of the three primary germ layers in the very early human embryo . The other two layers are the ectoderm (outside layer) and mesoderm (middle layer), with the endoderm being the innermost layer. (of a substance or process) Originating from within a system (such as an organism, tissue, or cell), as with endogenous cannabinoids and circadian rhythms . Contrast exogenous . A type of organelle found in eukaryotic cells that forms an interconnected network of flattened, membrane-enclosed sacs or tube-like structures known as cisternae. The tissue produced inside the seeds of most of the flowering plants following fertilization.


The efficiency of cysteine-mediated intracellular retention determines the differential fate of secretory IgA and IgM in B and plasma cells

Previous studies on IgM secretion demonstrated a role for the μ chain C-terminal cysteine (Cys575) in preventing the transport of unpolymerized subunits along the secretory pathway. The sequence homology between the C-terminal tailpieces of μ and α heavy chains prompted us to investigate the role of cysteine-mediated retention in the control of IgA secretion during B cell development. Similar to IgM, IgA are not secreted by B lymphocytes: the retention mechanism can be reversed by the reducing agent 2-mercaptoethanol, suggesting that disulfide interchange reactions are involved in the quality control of both IgM and IgA. Yet, α2L2 subunits, but not μ2L2, are secreted constitutively by plasma cells. We demonstrate that the differential retention of IgM and IgA subunits by myeloma transfectants is mainly due to the presence of an acidic residue upstream the α chain C-terminal cysteine. The regulation of polymeric Ig secretion during B cell development provides an example of how thiol-mediated quality control can be modulated according to the aminoacidic context surrounding the critical cysteine and to the cell type.


Retention and Intracellular Distribution of Instilled Iron Oxide Particles in Human Alveolar Macrophages

Bronchoalveolar lavage (BAL) was used to sample retention of particles within the alveolar macrophage (AM) compartment at various times from 1 to 91 d following intrapulmonary instillation of 2.6-μm-diameter iron oxide (Fe2O3) particles in human subjects. Particles were cleared from the lavagable AM compartment in a biphasic pattern, with a rapid-phase clearance half-time of 0.5 d and long-term clearance half-time of 110 d, comparable to retention kinetics determined by more traditional methods. The intracellular distribution of particles within lavaged AMs was similar in bronchial and alveolar BAL fractions. AMs with high intracellular particle burdens disappeared from the lavagable phagocytic AM population disproportionately more rapidly (shorter clearance half-time) than did AMs with lower particle burdens, consistent with the occurrence of a particle redistribution phenomenon as previously described in similar studies in rats. The rates of AM disappearance from the various particle burden categories was generally slightly slower in bronchial fractions than in alveolar fractions. The instillation of particles induced a transient acute inflammatory response at 24 h postinstillation (PI), characterized by increased numbers of neutrophils and alveolar macrophages in BAL fluids. This response was subclinical and was resolved within 4 d PI.

Knowledge about the role of alveolar macrophages (AMs) in the long-term retention and clearance of particles deposited in the alveolar region of the lung has been derived predominantly from animal studies. These studies indicate that AMs rapidly phagocytize particles deposited on the alveolar surface (1-3). Although some particles may be transported to regional lymph nodes (4, 5) or become sequestered in the pulmonary interstitium or epithelium (especially at high particulate lung burdens), the vast majority are thought to eventually leave the lung as intracellular particles within AMs, predominantly by the tracheobronchial route (6, 7). Thus, particle clearance is intimately linked to egress of AMs from the lung. Such a scenario is presumed also to occur in clearance of particles from the human lung. Animal studies (2, 7, 8) indicate that a proportion of deposited particles remains sequestered in AMs for extended periods, possibly as a result of “redistribution” of particles among AMs. This might occur as the result of exocytosis of particles or release of particles from lysed senescent AMs and subsequent phagocytosis by new macrophages. Phagocytized particles may, thus, remain in the lung via passage from one macrophage to another instead of being cleared from the lung. In addition to physical transport out of the lung, some portion of a lung particle burden may be cleared by slow dissolution of particles within alveolar macrophages (9). The kinetics of particle clearance from the lungs of different species vary tremendously (10), with humans being the slowest and the rat being the most rapid in clearing a particle burden. The causes for this disparity between species are not known and may include differences in anatomy or fundamental clearance mechanisms.

Studies in human subjects have examined particle retention and clearance by monitoring radioactivity emitted from radiolabeled particles deposited in the lung (11-13). Many investigators have used inhaled particles with short-lived radiolabels to examine short-term clearance (tracheobronchial clearance and rapid-phase alveolar clearance) during the first 24 to 48 h following deposition (14, 15). A few studies have used longer lived radiolabels to study long-term kinetics of particle retention and clearance (11, 13, 16). One study compared long-term pulmonary clearance of inhaled cobalt oxide in multiple species and found marked differences in particle retention between species over the 180 d following particle deposition (10). Pulmonary particle retention was definitively greater in humans and baboons than in the other species studied, clearly demonstrating the limitations of extrapolating animal-derived clearance data to humans. None of these studies have directly examined the role of AMs in the retention or removal of particles deposited in the alveolar region of the human lung.

The current study departs from more traditional methods and directly examines retention and distribution of particles within AMs lavaged from the lungs of human subjects following intrapulmonary instillation of particles. This approach, similar to that employed in previous animal studies (8), provides a means for evaluating possible particle redistribution within the human AM compartment. Our objectives were to quantify and compare the retention and intracellular distributions of insoluble particles within lavagable alveolar and airway macrophages as a function of time following instillation. By measuring relative rates of clearance of AMs having different intracellular particle burdens, we hoped to demonstrate whether there was a “redistribution” of particles between AMs in the human lung, similar to that seen in rats. In addition, after making certain assumptions, we hoped to estimate the overall particle retention and clearance kinetics for particles in the lavagable AM compartment.

Thirty healthy, nonsmoking volunteers (24 male, 6 female), 19.6 to 35.5 yr of age (mean age, 25.5 ± 4.3 yr) participated in the study. Potential subjects were excluded from participation if they had a history of smoking, asthma, allergy, cardiac disease, chronic respiratory disease, or recent acute respiratory illness. All potential subjects underwent screening procedures, including completion of the Minnesota Multiphasic Personality Inventory and medical history form, physical examination, chest radiographs, and routine hematological and serum chemistry tests. Accepted subjects were informed of the purposes, experimental protocol, and procedures of the experiments, as well as potential risk from participation, and each subject signed a statement of informed consent. This study was approved by the Committee on the Protection of the Rights of Human Subjects of the University of North Carolina School of Medicine (Chapel Hill, NC).

Subjects were each assigned to one of five groups of six subjects each. Each subject underwent two bronchoscopy procedures. During the first bronchoscopy, inert, insoluble iron oxide (Fe2O3) microspheres suspended in nonpyrogenic, sterile physiologic saline solution (SPSS) (Baxter Healthcare Products, Deerfield, IL) were instilled into an identified subsegment of the lingula that could readily be wedged by advancing the bronchoscope. As a control, SPSS (without particles) was instilled into a segment (medial or lateral) of the right middle lobe. Subsequently, during the second bronchoscopy procedure, particles and cells were recovered by bronchoalveolar lavage (BAL) at a specified time (1, 2, 4, 28, or 91 d) postinstillation (PI). Total and differential cell counts, total recovered particles, and particles per cell were tabulated for the bronchial and alveolar wash fractions.

Iron oxide was chosen as the test particle for this study because of its safety, and because it is inert and relatively insoluble in aqueous suspension at neutral pH. It is reported to be nontoxic, nonfibrogenic, and noncarcinogenic (17), and has been used previously in humans for inhalation studies of mucociliary clearance (18-20).

Spherical Fe2O3 particles (nonradioactive) were generated as previously described (21, 22) from suspensions of colloidal Fe2O3 (23) using a spinning disk aerosol generator (24), but without radioactive label. The count median diameter of the resultant particles was 2.6 μm, with a geometric standard deviation (σg) of 1.3. The particles were collected in SPSS in an impinger, concentrated by centrifugation, and then washed twice in SPSS. Initial particle batches were sterilized by autoclaving at 121°C for 30 min. Later batches were sterilized by baking the particles at 250°C for 3.5 h, which also ensured the destruction of any endotoxin activity that might be present in the particle suspension. Batches of all the particle suspensions were tested for endotoxin activity using a gelation-capillary method (Endotect ICN Biomedical, Costa Mesa, CA) or using a semiquantitative method (performed by the University of North Carolina Tissue Culture Facility), both of which are based on the Limulus amebocyte lysate (LAL) assay. The capillary LAL method detects endotoxin concentrations as low as 0.06 to 0.10 ng/ml and provides only a positive or negative indication of the presence of endotoxin. The semiquantitative LAL method is equally as sensitive, and provides an indication of the actual concentration of endotoxin present. All particle suspensions tested by the capillary method were negative. Particle suspensions tested by the semiquantitative LAL method were ⩽ 0.06 endotoxin units (1 EU = 0.1 ng/ml).

Just before instillation, concentrated particles were suspended in 2 to 3 ml of SPSS and placed in an ultrasonic bath for 30 min to disperse clumps of particles. Particles were examined and counted in a hemacytometer to assure the dispersion of clumps and to quantify particle numbers. Finally, 3.0 × 10 8 particles were suspended in 10 ml of SPSS and transferred to a sterile syringe for instillation.

Bronchoscopy and BAL were performed as previously described (25). Before bronchoscopy, all subjects were premedicated intravenously with 0.6 mg of atropine. The posterior pharynx was anesthetized by gargling with a saline solution containing 4% lidocaine, and the nasal passage was anesthetized with a lubricating jelly containing 2% lidocaine. The larynx, trachea, and bronchi were anesthetized with topical 2% lidocaine instilled through a fiberoptic bronchoscope (BF type 1T20D Olympus, Lake Success, NY) to control coughing. The total dose of instilled lidocaine was limited to no more than 300 mg.

To instill the particles into the distal airways and alveoli, the bronchoscope was passed to a wedgeable subsegmental bronchus in the lingula, but was not wedged. A Teflon catheter was passed through the biopsy channel and then extended 4 to 5 cm beyond the tip of the bronchoscope into the selected subsegmental bronchus. Subjects were instructed to take deep, slow, and regular breaths. Ten milliliters of SPSS containing 3.0 × 10 8 Fe2O3 microspheres was slowly instilled through the catheter coincident with inspirations to maximize placement of particles in the alveolar region. This was followed by an additional 10 ml of SPSS from a different syringe (for a total of 20 ml), with the intent of washing particles remaining in airways into the alveoli. As a control, 20 ml of SPSS (without particles) was similarly instilled into the medial segment of the right middle lung lobe. To assess the number of particles that were lost to the syringe and catheter, simulated instillations were performed in vitro by injecting particle suspensions through the catheter into a glass vial and counting the particles deposited in the vial. On the basis of these simulations, almost one-third of the particles (31.4 ± 2.2%) were lost to the syringe and catheter, so the actual number of particles instilled into the lung is estimated to be 2.06 (± 0.07) × 10 8 particles (∼ 5 mg of Fe2O3).

Segmental BAL was performed at a specific time interval PI in the same lingular segment in which Fe2O3 was previously instilled and in the control segment in the right middle lobe. The lavage of each segment comprised six washes using a total of 270 ml of SPSS per segment. The first washing was done with only 20 ml of SPSS, and was considered to be enriched with materials from the peripheral airways (26). BAL fluid from the first wash was kept separate from five subsequent washings of 50 ml each. Similarly, the control subsegment was lavaged as described. BAL fluid and cells from each individual washing were collected in separate capped tubes and kept on ice during the bronchoscopy, and during processing.

BAL fluids from the particle-instilled segment (lingula) and control segment (right middle lobe) were processed separately, but in identical fashion, as described subsequently. BAL fluids were centrifuged at 250 × g for 10 min. Cells from the bronchial fraction were kept separate, whereas cells from the five 50-ml washes (alveolar fraction) were pooled, washed twice with tissue culture medium (RPMI 1640 Sigma Chemical, St. Louis, MO), and used immediately for total and differential cell counts. Total cell counts were obtained by light microscopy, using a hemacytometer. Differential cell counts were obtained using slides prepared in a cytocentrifuge (Cytospin 3 Shandon, Pittsburgh, PA) at 500 rpm for 3 min. Slides were stained with a modified Wright's stain (Leukostat stain Fisher Scientific, Fairlawn, NJ) and at least 300 cells were counted and evaluated.

We made the following assumptions regarding the recovery of particles by bronchoalveolar lavage in order to analyze and interpret the data we collected:

1. The vast majority of particles retained within the lung are located within alveolar macrophages located within lavagable airspaces.

2. Translocation of particles from the airspaces into the pulmonary interstitium is minimal during the 91-d course of the study.

3. Dissolution of particles is negligible during the 91-d course of the study.

4. The number of particles recovered by BAL is proportional to the number of particles present within the bronchial and alveolar airspaces accessible to lavage.

5. The efficiency of BAL in recovering particles is similar from one time point to another following particle instillation.

Counts of particles and intracellular particles per cell were performed by light microscopy, using a ×100 oil immersion objective lens. One thousand AMs were counted and the number of Fe2O3 particles contained within the margins of each cell was tabulated. Particles located within the margins of the cell were assumed to be intracellular particles and all other particles were considered extracellular. Only intact cells with minimal degenerative cytological changes were included in the count. The number of extracellular particles encountered (per 1,000 macrophages counted) also was tabulated, as was the number of particles associated with degenerated cells and particles contained within neutrophils. The total number of particles recovered by BAL was then calculated using the total number of intracellular and extracellular particles counted and the total cell counts. Data from the six subjects at each time interval were averaged to provide a mean number of recovered particles for each time point (1, 2, 4, 28, and 91 d PI). Because we did not attempt lavage to recover particles immediately following instillation, a value for the number of particles that might have been recovered by BAL at t = 0 was estimated by extrapolation, using a single exponential decay function fit to data from Days 1 and 2 PI.

By a least-squares method, a double-exponential decay function (Equation 1) was fit to the data (total particles recovered versus time), using computer software (DeltaGraph 4.0 DeltaPoint, Monterey, CA):

Number of particles = Ae − λ 1 t + Be − λ 2 t Equation 1

The half-time (t1/2) for each of the two components of the curve was calculated (equation 2) as a function of the exponential decay constant (λ):

t 1 / 2 = ln 2 / λ i = 0.693 / λ i Equation 2

The number of AMs containing various particle burdens (i.e., categorized as particles per cell: 1, 2–4, 5–7, 8–11, 12– 19, ⩾ 20 particles) was determined and expressed as a percentage of the number of AMs that had phagocytized at least one particle (particle-laden AMs), rather than the total number of AMs recovered (total AMs). (This was necessary to allow comparisons of the particle distributions in the alveolar fraction with those in the bronchial fraction.) A single exponential decay function (Equation 3) was fit by the least-squares method to the mean percentage of AMs with a given particle burden to describe the loss of AMs from the various categories between Days 4 and 91 PI.

Percentage AMs = Ae − λ t Equation 3

The “one particle per cell” category was a special case that required a positive exponential function (Equation 4) to describe the change in percentage of AMs in this category between Days 4 and 91 PI.

Percentage AMs = Ae λ t Equation 4

The half-times or doubling times were calculated as described previously (Equation 2).

The calculated coefficients (A), rate constants (λ), and clearance half-times (t1/2) derived from Equations 3 or 4 were tabulated by particle burden category and the trend toward increasing or decreasing rate across the various categories was compared for alveolar and bronchial fractions.

All values are expressed as the mean ± standard error. Differences between particle-instilled versus control segments and for bronchial versus alveolar fractions for various parameters were analyzed using Student's t test for paired samples (27). Differences in various parameters (total particles recovered, particles per phagocytic cell, etc.) at different times PI were evaluated using analysis of variance (ANOVA) and post hoc hypothesis testing for differences between groups using the pairwise Tukey's honestly significant difference (HSD) test. Pearson's correlation coefficient was calculated to determine the significance of trends in clearance rate constants across particle burden categories, and analysis of covariance (ANCOVA) was used to compare the trends between bronchial and alveolar fractions. The rate constants were first transformed to their natural logarithms before doing this analysis. A P value of 0.05 was chosen as the level of significance for all statistical tests.

Retention kinetics of particles recovered by BAL were assumed to be representative of the total burden of particles within the alveolar spaces (2). On average, no more than 10% of the particles instilled could be recovered by BAL (combined bronchial and alveolar) at any time PI. The mean number of particles recovered at 91 d PI was only 32% of that recovered at 1 d PI however, this difference was not statistically significant (ANOVA, P = 0.11) owing to large variances in particle recovery from individuals within each group. A retention curve fit to the mean values (Figure 1 ), using an estimated value of 37.2 × 10 6 particles for t = 0, was best described (r 2 = 0.91) by a double-exponential decay function as follows:

Number of particles = ( 1.67 × 10 7 ) ( e − 0.0063 t ) + ( 2.07 × 10 7 ) ( e − 1.41 t ) Equation 5

Fig. 1. Mean number of particles recovered by BAL at various times PI: A double-exponential decay function fit to the data shows a very rapid clearance (t1/2 = 0.5 d) during the first 2 d PI, followed by a prolonged slow clearance phase (t1/2 = 110.1 d). The fitted equation is as follows: Number of particles = (1.671 × 10 7 ) (e −0.006297t ) + (2.068 × 10 7 ) (e −1.4066t ). Bars represent standard error.

A rapid decrease in lavagable particles occurred during the first 4 d (t1/2 = 0.5 d) and was followed by a much slower decay in lavagable particle numbers between 4 and 91 d (t1/2 = 110.1 d).

The percentage of particles that were extracellular and not obviously associated with a cell disrupted during centrifugation was higher in the bronchial fraction and in the early time points, 1 to 4 d PI (Figure 2 ) relative to the alveolar fraction and also to the bronchial fraction at 28 and 91 d PI. The percentage of free particles in the alveolar BAL fraction also was elevated at 1 d PI (P ⩽ 0.05) relative to 4, 28, and 91 d PI.

Fig. 2. The proportion of free particles in the bronchial fraction (as the percentage of the total counted) tended to be greater in the early time points (1 to 4 d PI) as compared with the alveolar fraction and the bronchial fraction at 28 or 91 d PI. The percentage of free particles in the alveolar fraction was significantly elevated only at 1 d PI. Bars represent standard error. *Bronchial fraction statistically different from alveolar fraction (< 0.05, paired t test). † Bronchial fraction statistically different from bronchial fraction at 28 and 91 d PI. ‡ Alveolar fraction statistically different from alveolar fraction at 4, 28, and 91 d PI.

The mean percentage of the total AMs, which had phagocytized one or more particles (particle-laden AMs), appeared to increase slightly between 1 and 91 d PI in both bronchial and alveolar fractions (Figure 3 ). These apparent increases were not statistically significant. The mean percentage of particle-laden AMs appeared to be slightly higher in the bronchial fraction and was significantly higher than that of the alveolar fraction at 91 d PI (paired t test, P = 0.04). There was an apparent decrease of 34.6% in the total number of particle-laden AMs between 1 and 91 d PI (Figure 3 ) however, this change was not statistically significant owing to large variances within groups.

Fig. 3. (Top) The total number of particle-laden AMs recovered by BAL (combined alveolar + bronchial fractions) decreased slightly between 1 and 91 d PI (no statistically significant change). Bars represent standard error. (Bottom) The percentage of particle-laden AMs appeared to increase slightly between 2 and 91 d PI in both alveolar and bronchial BAL fractions. The percentages of particle-laden AMs were lowest at 1 d PI, owing to the transient influx of AMs. *Alveolar fraction statistically different from bronchial fraction (P = 0.035, paired t test). Bars represent standard error.

Particles were observed almost exclusively in AMs and rarely in neutrophils. The distribution of particles within the lavagable AMs was heterogeneous, and changed slightly as a function of time PI (Figure 4 ). The vast majority of AMs at all time intervals contained no particles and, of the cells that had phagocytized particles, most contained only 1 or 2 particles, but as many as 72 particles were observed within a single AM. The proportions of AMs in all categories increased exponentially from zero as particles were phagocytized during the first 24 h PI, and continued to increase slightly between 1 and 4 d, with the exception that the “one particle per cell” category declined slightly between 1 and 4 d PI. This initial growth phase was followed by decline, which is evident between 4 and 91 d PI, most prominently in the higher burden categories. The proportion of AMs in the “one particle per cell” category, however, increased slowly between 4 and 91 d (doubling time, 155 days). In the lower burden categories (up to seven particles), the majority of the cell loss occurred between 28 and 91 d PI, whereas in larger particle burden categories (eight or more particles), loss of cells began earlier, between 4 and 28 d, and continued through 91 d PI. The percentage of cells in each of the three largest burden categories was significantly lower at 91 d than at 4 d PI (ANOVA and Tukey's HSD post hoc comparisons, P < 0.05). The coefficients, decay constants, and half-times for long-term exponential functions fit to the various categories are listed in Table 1 for both alveolar and bronchial fractions. It is clear from these fitted parameters that there was a progressive increase in the rate of disappearance of particle-laden AMs as their particle burdens increased. On the basis of the calculated half-times, AMs in the 20+ particle category cleared approximately 40 times faster than AMs in the 2- to 4-particle category.

Fig. 4. The distributions of particle-laden AMs in the various particle burden categories are similar in bronchial and alveolar fractions, especially for smaller particle burden categories. In the alveolar fraction, the percentage of cells in the larger categories clearly decreased more rapidly than in smaller burden categories. (Error bars were intentionally omitted to avoid excessive clutter.) *Significantly different from 4 d PI (ANOVA, P < 0.05). † Significantly different from corresponding value in alveolar fraction.

Table 1. Fitted parameters for exponential decay function *

* These parameters represent the coefficients (A) and rate constants (λ) of long-term retention functions corresponding to Equations 3 or 4.

‡ Value for 1 particle per cell category is doubling time, not half-time.

As in the alveolar fraction, particles were observed almost exclusively in AMs and occasionally in neutrophils. Compared with the alveolar fraction, there were many degenerate cells in the bronchial lavagate, many of which were probably epithelial cells. Degenerated or lysed cells with associated particles were presumed to be AMs however, it is possible that some were epithelial cells. We did not see particles associated with cells definitively identified as epithelial cells. The proportional distributions of AMs in the four lowest particle burden categories (1 through 8–11 particles) at the various times PI were similar to those of the alveolar fraction (Figure 4 ). In contrast to the alveolar fraction, the percentages of phagocytic AMs in the two highest particle burden categories (12 to 19, and 20 or more particles) in the bronchial fraction remained relatively constant between 1 and 28 d PI and diminished slightly between 28 and 91 d PI (not statistically significant, ANOVA). The percentage of phagocytic AMs in the 20-or-more particle category was significantly lower in the bronchial fraction compared with the alveolar fraction at 4 d PI (0.35 ± 0.26 versus 1.74 ± 0.48, paired t test, P = 0.04) however, there was no significant difference between bronchial and alveolar fractions at 91 d PI for either of these two highest particle burden categories.

Differences in disappearance of AMs from corresponding particle burden categories of bronchial and alveolar fractions are most apparent as differences in clearance rate constant (λ) and t1/2 as listed in Table 1. Pearson's correlation coefficients for particle burden category versus λ were significantly greater than zero for both alveolar and bronchial fractions (P = 0.003 and P = 0.019, respectively), indicating trends toward increasing rates of clearance (AM disappearance) as a function of increasing particle burden. Regression lines demonstrating trends in rates for the two BAL fractions are plotted in Figure 5 . The slopes of the two trend lines are slightly (but not statistically) different however, the lines are different as defined by differences in their respective y intercepts (ANCOVA, P = 0.006).

Fig. 5. The rate constants governing the disappearance of AMs from the various particle burden categories tended to increase with increasing intracellular particle burden for both alveolar and bronchial fractions. Pearson's correlation coefficients (r) for alveolar (0.981, P = 0.003) and bronchial fractions (0.936, P = 0.019) are significant and positive. The slopes of the regression lines are similar, but y intercepts are significantly different (P = 0.006).

The instillation of Fe2O3 particles into the lingular subsegment resulted in a transient inflammatory response that was apparent in some of the subjects at 1 d PI. This cellular response was characterized by the influx of both AMs and neutrophils (Table 2). Although there were large differences in the mean number of cells recovered from control and particle-instilled segments, large variances in cell numbers in the lingular lavagate prevented the differences from being statistically significant. The number of AMs in BAL fluids from the particle-instilled segment returned to control levels by 2 d PI. The mean total number and percentage of neutrophils in the lingular alveolar BAL fluid was still marginally elevated at 2 d PI (although not statistically significant), and were no different from control values at 4 d PI and later.

Table 2. Total cells, alveolar macrophages, and neutrophils in BAL fluid from particle-instilled and control (saline-instilled) segments *

* Twenty-four hours postinstillation. All values are mean ± standard error.

† Student's t test for paired measurements, P value ⩽ 0.05 indicates statistical significance. Large variances in cell counts in the particle-instilled segment prevented the differences from being statistically significant.

‡ Combined bronchial and alveolar fractions.

The relationship between lavagable particle burden and total particle burden has been clearly demonstrated by Lehnert and colleagues (8), who showed in rats that the lavagable burden was a proportional reflection of the total lung burden. Studies in sheep (7) and rats (2, 8, 28) showed that the bulk of the pulmonary particle burden is associated with AMs and that the AM population sampled by BAL is representative of the overall AM population with respect to the intracellular particle distribution. Realizing that we did not recover all the particles in the lung, or even all the particles in the lavagable spaces, we contend that in our study BAL resulted in recovery of a quantity of particles that is proportional to the total lung burden and that could be used to study changes in intracellular particle distribution and estimate retention and clearance kinetics for particles in the lavagable AM compartment.

Our comparisons of intracellular particle distributions at the various time points clearly demonstrate disproportionate rates of cell loss from the various categories in both alveolar and bronchial fractions. The rate of cell disappearance is dramatically greater in the high particle burden categories, similar to the findings in previous studies (8). The continued growth of the “one particle per cell” category in the face of decline in other categories might be explained by one of several mechanisms. The first is that cells in the higher categories may be preferentially cleared physically from the lung at a more rapid rate than cells in the smaller particle burden categories, thus the relative proportions of AMs in the smaller burden may actually continue to grow. This would require greater mobility and disproportionately more rapid movement onto the mucociliary apparatus or into the interstitium by AMs with high particle burdens. Evidence provided by other investigators, however, indicates that AMs heavily laden with particles actually tend toward decreased mobility (28, 29). A second explanation might be a change in the lavagability of AMs in the various particle burden categories with the passing of time. This seems unlikely because findings similar to ours were made by Lehnert and associates (8), who examined not only lavaged AMs, but also AMs remaining in the lung after lavage.

A third, and perhaps most probable, explanation might be that particles released by cells in the higher burden categories are rephagocytized by other cells, resulting in “redistribution” of particles from one cell to another. The possible mechanisms underlying cell-to-cell particle redistribution have previously been discussed in detail elsewhere (30). The cells that phagocytize the released particles are most likely to be cells that previously did not contain particles, because, proportionally, they are much more abundant than particle-laden AMs. This redistribution might occur following exocytosis of particles by viable cells, lysis of dead or degenerate cells, or phagocytosis of whole dead or degenerating cells. Our data seem consistent with the possible occurrence of a particle redistribution phenomenon in our human subjects. The true explanation for our observations may be a combination of mechanisms rather than just one single mechanism.

The proportions of AMs in the various particle burden categories were similar in alveolar and bronchial fractions, although there were apparent differences in the rates of AM disappearance from corresponding categories in the two BAL fractions. We interpret this to indicate that many of the AMs in the bronchial fraction are most likely egressing AMs that have moved from the alveolar region into the airways, resulting in an apparent lag in clearance from the bronchial region. This also suggests that mobility of AMs toward the bronchial airways may not be influenced by their particle burdens.

The fast clearance phase (t1/2 = 0.5 d) found in our study is much faster than that (t1/2 = 12–19 d) found by others in rats (8, 31) and is representative of the early clearance (0 to 4 d), which probably includes mucociliary clearance of particles from small peripheral airways in addition to rapid-phase alveolar clearance. Our data do not allow for the resolution of a distinct intermediate phase of relatively rapid alveolar clearance comparable to that described in the rats (8). It is incorporated into the long-term clearance phase and undoubtedly influences our calculated value for the long-term clearance half-time. Additional subjects and groups examined between 4 and 28 d PI and beyond 91 d PI would probably allow for more confidence in resolving fast and slow components. Given the marked disparity in long-term clearance rates between humans and rats (10), we would have expected to see a much slower long-term clearance half-time in our human subjects as compared with rats (8).

The long-term clearance half-time of 110 d found in our BAL study is within the range of half-time values (62 to 300 d) found by others using radioactive tracer or magnetic methods to measure clearance of iron oxide particles (32-34), polystyrene (12, 13), or Teflon particles (20). This is much faster, however, than the mean 272-d half-time found by Bailey and coworkers (11) for clearance of radiolabeled 3.9-μm fused aluminosilicate particles in humans, in which it was found that the calculated half-time increased with increasing length of the study. Thus, the calculated half-time in our study may have been affected by the relatively short length of the study period.

Our technique only samples the retention of the lavagable cells and particles whereas the external monitoring of inhaled radiolabeled particles assesses retention of all particles, including those sequestered within epithelial cells, the interstitium, and thoracic lymph nodes. Thus, our method tends to underestimate retention and overestimate clearance of particles when there is significant movement of particles into the interstitium. It is likely that the large number of particles and the transient inflammation in our study may have resulted in greater than usual access of particles to the interstitium, where they would be inaccessible to lavage. Studies in mice (35) and rats (36), however, indicate that instilled inert particles of at least 1-μm diameter are unlikely to penetrate to the interstitium. Even so, because the majority of inhaled particles become associated with AMs (2, 7) and because the lavagable particle burden is proportional to the total burden (8), it is likely that sampling by BAL reflects the kinetics of retention and clearance of particles in the AM compartment and within the alveolar spaces.

A transient cellular influx, similar to that in the current study, has been observed following instillation of polystyrene (37) or carbon particles (38) and following inhalation of ferric oxide dust (39). This inflammation may result from release of neutrophil chemoattractants by AMs (40), complement activation (41), or the presence of small amounts of soluble ferric ion (Fe 3+ ) (42) that may have been associated with the particles used in our study. The sudden introduction of large numbers of particles and subsequent phagocytic activity by AMs also may result in accidental release of lysosomal contents (hydrolases, proteases, reactive oxygen species, and other products) during phagocytosis (premature fusion of lysosome with phagosome), leading to inflammation.

Studies have examined and quantified particles within lavaged AMs in attempts to index pulmonary particle burdens in occupationally exposed individuals (43). Because occupational dust exposures generally involve nonradioactive materials, estimation of pulmonary particle burden and clearance kinetics is difficult. The current study demonstrates that sampling of the lavagable particle burden by BAL over a period of time can yield an estimate of particle retention kinetics comparable to that obtained by other, more traditional methods, such as external monitoring of radiolabeled particles. BAL, thus, may be useful not only for assessing pulmonary particle burdens, but also for predicting particle retention kinetics following occupational inhalation exposure to insoluble dusts.

This is the first study to employ intrapulmonary instillation of particles and BAL to study kinetics of pulmonary particle retention and clearance in human subjects. It demonstrates the usefulness of BAL for studying intrapulmonary particle burdens by sampling lavagable AMs, which are crucial for clearance of particles from the alveolar region and that also serve as a compartment for storage or sequestration of a large proportion of the total lung burden of insoluble particles. With this technique we demonstrated disproportionate “clearance” (disappearance) of AMs with high particle burdens, suggestive of a particle redistribution phenomenon similar to that described in rats. In addition, we were able to estimate a long-term clearance half-time comparable to that determined by more traditional methods. Finally, we demonstrated a transient acute inflammatory response to the particles at 1 d PI, a finding that may be important in the light of studies showing acute adverse health effects of ambient particulate air pollution.

The authors acknowledge and thank Alex Chall, Debra Levin, Maryann Bassett, and Drs. Tim Gerrity, Hillel Koren, William McDonnell, Brian Boehlecke, Frank Biscardi, Mark Robbins, and Greg Bottei for their efforts and advice in performing various aspects of this work.


Part 3: Super Resolution Imaging

00:00:00.22 So, welcome to this seminar series
00:00:03.06 on Breakthroughs in Fluorescent Imaging.
00:00:08.02 In this third section,
00:00:09.19 I'd like to talk about
00:00:11.06 super-resolution imaging
00:00:13.04 using photoactivatable fluorescent proteins.
00:00:16.22 This approach of super-resolution imaging
00:00:19.13 allows us to visualize the behavior
00:00:22.12 of individual molecules,
00:00:24.26 which fluorescent proteins
00:00:27.12 with conventional diffraction-limited imaging,
00:00:30.06 cannot allow you to look at.
00:00:31.22 Instead, you're looking at ensembles of proteins.
00:00:35.16 Now, to get a framework for what we're talking about
00:00:39.00 with super-resolution imaging,
00:00:42.00 I have a little diagram here illustrating really
00:00:46.27 the spatial scale that fluorescence microscopy,
00:00:50.01 in its conventional format,
00:00:52.07 enables us to
00:00:55.19 experience or visualize.
00:00:58.05 So, conventional fluorescent microscopy
00:01:00.10 has a lateral dimension
00:01:02.28 of anywhere between 400 nm to tens of microns
00:01:07.01 in imaging capability.
00:01:10.12 But many molecular structures within cells
00:01:13.20 are well below 400 nm in size.
00:01:17.16 And so it's been a challenge of biologists
00:01:20.23 to image in this nanometric region.
00:01:23.27 And this is the region that we call
00:01:25.28 super-resolution imaging.
00:01:27.28 Anything from just a couple nanometers
00:01:30.20 up to about 200 or 400 nanometers in size
00:01:34.13 is in the realm of super-resolution imaging.
00:01:39.13 Now, why has there been a problem
00:01:43.03 for imaging objects as small as things like GFP,
00:01:47.24 which is about 2.5 nm in diameter.
00:01:51.24 Well, the problem is the diffraction limit of light:
00:01:55.13 if we image a single molecule of GFP
00:01:58.27 through a microscope,
00:02:00.18 what one sees is not a single 2.5 nm spot,
00:02:05.07 instead what you see is a very large blurry spot
00:02:09.28 called the microscope point spread function,
00:02:13.08 that is 100 times the size
00:02:16.09 of the single molecule of GFP.
00:02:19.28 Now, if we have a specimen
00:02:23.05 that's expressing many molecules
00:02:25.23 that are all within 200 nm,
00:02:28.23 which is the diameter of this point spread function
00:02:31.22 of a single molecule,
00:02:33.27 you can easily see how you'd have no ability
00:02:36.29 to define how individual molecules
00:02:39.12 are distributed within this blurry spot.
00:02:43.10 And as a consequence, you have no insight
00:02:45.06 into how molecules are distributed in nanometric structures
00:02:49.17 that make up the vast majority of molecular machines within cells.
00:02:55.26 Well, there's one way to get around this diffraction limit
00:03:00.26 using an interesting approach,
00:03:04.08 which is the recognition that if one looks at a single molecule,
00:03:10.13 the microscope point spread function,
00:03:13.08 or blurry spot,
00:03:15.02 has a Gaussian spread of distribution
00:03:18.05 when you look at it in x and y.
00:03:21.01 So, if you were imaging a single fluorescent protein
00:03:25.14 you can, with fairly good accuracy,
00:03:27.14 determine where the molecule must exist
00:03:31.09 within this PSF
00:03:33.26 by simply fitting,
00:03:35.13 applying a 2D Gaussian least squares fit
00:03:38.01 to determine the centroid of this Gaussian.
00:03:41.27 When one does that you can, with very good accuracy,
00:03:44.18 determine where the molecule is situated
00:03:48.15 within that blurry spot.
00:03:51.10 Now, this approach of fitting the blurry point spread function
00:03:56.01 exhibited by fluorophores
00:03:58.12 has been used, to very good avail,
00:04:02.05 at determining how single molecules
00:04:05.11 move and behave
00:04:07.25 when they are expressed in vitro.
00:04:10.12 And this is just illustrated in this diagram right here,
00:04:14.02 and up here in a little cartoon fashion,
00:04:17.04 where researchers looked at the behavior
00:04:20.03 of individual motor proteins,
00:04:22.01 in this case myosin,
00:04:24.12 moving on an actin filament.
00:04:27.07 And what you can see is
00:04:28.24 the Gaussian point spread function
00:04:30.19 given off by the single myosin molecule
00:04:33.24 can be fit, with very good accuracy,
00:04:36.17 to determine the nanometric steps
00:04:39.09 that this motor takes in time.
00:04:42.19 This is possible because of the ability
00:04:45.20 to fit these blurry spots
00:04:49.13 given off by these fluorophores
00:04:51.13 in the way that I have told you.
00:04:54.10 Now, the problem comes if you're interested
00:04:56.25 in looking at more than one molecule
00:05:00.08 in a dense population.
00:05:02.03 And this is what's typical for how molecules
00:05:04.07 are distributed within cells.
00:05:06.25 They are densely packed within cells.
00:05:10.03 This approach of fitting individual fluorescent probes
00:05:15.12 using this kind of Gaussian fitting system
00:05:19.20 falls apart under these conditions,
00:05:21.16 when you have many molecules,
00:05:23.27 because you don't know whether
00:05:25.07 in any particular PSF,
00:05:27.23 which it has a radius of anywhere between 200-400 nm,
00:05:32.23 whether there's a single molecule or hundreds of molecules.
00:05:36.28 So your localization distance is essentially
00:05:41.12 lost through this approach.
00:05:43.27 So one way to get around this problem
00:05:47.04 where the point spread function,
00:05:50.07 the blurry distribution of this point spread function,
00:05:54.20 masks the distribution of hundreds of different molecules,
00:05:58.08 is the use of photoactivable fluorescent proteins.
00:06:02.22 These proteins, as I mentioned in the previous talks,
00:06:07.11 switch on from a dark to a light state.
00:06:10.27 What that allows you to do
00:06:12.27 is to switch on molecules
00:06:14.22 one at a time
00:06:16.18 and to potentially build the distribution
00:06:19.13 of a dense population of molecules.
00:06:23.01 And this is the basis of a new super-resolution approach
00:06:27.01 called Photoactivated Localization Microscopy.
00:06:31.27 Now, in this technique,
00:06:33.16 which typically uses fixed cells that are not moving,
00:06:38.16 a specimen that houses thousands of
00:06:42.12 photoactivatable fluorescent proteins,
00:06:44.23 whose distribution you'd like to know,
00:06:47.04 is switched on with very low light.
00:06:50.08 The low light flips on a small subset
00:06:55.09 of the overall population of molecules,
00:06:58.01 randomly.
00:06:59.16 And so the probability
00:07:01.04 that two or more of these molecules
00:07:03.10 that switch on have their blurry spots overlapping
00:07:08.12 is quite small.
00:07:10.03 So when you switch on a small subset
00:07:12.17 with this low light illumination,
00:07:14.27 you can then fit the PSFs
00:07:18.12 using the Gaussian fitting algorithm
00:07:20.15 to determine, with very high precision,
00:07:22.29 where those two molecules
00:07:24.26 in this case, that you switched on,
00:07:26.21 are distributed.
00:07:29.00 Now, once you've done that,
00:07:30.18 you can photobleach these molecules
00:07:32.23 and then photoactivate another small subset
00:07:37.15 of molecules,
00:07:38.20 again using very low light
00:07:40.19 which just randomly flips on a subset of these molecules.
00:07:45.09 Now, because this specimen is fixed,
00:07:48.07 you can now determine where these molecules
00:07:51.03 are distributed in the structure that you're looking at
00:07:55.08 using the fitting algorithm that I mentioned.
00:07:58.26 After fitting these molecules,
00:08:01.05 you can do another bleach and photoactivation
00:08:03.18 to switch on another population,
00:08:06.11 in this overall population,
00:08:08.25 and you can do this over and over again,
00:08:11.05 thousands of times.
00:08:13.07 And after you've collected the distributions
00:08:17.05 of all of these molecules,
00:08:18.23 you can then merge them into one big super-resolution map
00:08:23.22 showing how all of the molecules are distributed
00:08:27.00 within the fixed specimen.
00:08:29.01 Now, this movie sequence here
00:08:32.01 just illustrates how one can go about acquiring data
00:08:36.02 for this type of super-resolution analysis.
00:08:39.17 So this is a thin section
00:08:41.12 through lysosomes within cells
00:08:43.25 that are expressing a photoactivatable-tagged
00:08:47.10 lysosomal membrane protein.
00:08:49.16 To the right is the raw image,
00:08:52.04 where you can see how we're photoactivating the molecules
00:08:55.13 that are distributed on the membranes of these lysosomes.
00:08:59.11 This is the summed distribution of all of those molecules,
00:09:03.07 and here is the PALM image
00:09:04.26 that's being constructed
00:09:07.13 as we photoactivate individual molecules
00:09:10.23 in that thin section.
00:09:13.06 And with time, you can see we can build the super-resolution image
00:09:17.06 of all the molecules that were distributed
00:09:19.26 within this thin section of lysosomes.
00:09:23.05 So, the instrument that is used
00:09:24.28 to perform this super-resolution imaging
00:09:27.11 is actually quite simple
00:09:29.11 and this is one reason why many researchers are excited,
00:09:32.04 because they don't need much money
00:09:34.01 in order to do this type of experiment.
00:09:37.22 So, you need a cooled CCD camera
00:09:40.27 to image the individual photons that are being emitted
00:09:43.19 by these photoactivatable fluorescent proteins.
00:09:47.06 You also need a variety of different lasers
00:09:50.18 for activating, as well as imaging,
00:09:53.14 the photoactivatable fluorescent proteins,
00:09:55.29 and finally you need a
00:09:59.02 total internal fluorescence microscopic objective,
00:10:03.20 in order to be able to limit the sampling area
00:10:09.01 of your specimen
00:10:10.28 to only about 100 nm off the coverslip.
00:10:15.01 We typically use this because
00:10:17.07 if you just use a conventional objective
00:10:19.27 the fluorescence from out of focus molecules
00:10:25.18 greatly increases the background photons,
00:10:30.25 making it much more difficult
00:10:32.26 to precisely map the distribution of individual molecules.
00:10:37.13 Now here's an example of the type of resolution
00:10:39.29 that you can get using PALM super-resolution imaging.
00:10:44.16 To the right is an aggregate
00:10:47.04 of 50 nm beads
00:10:50.01 that have been labeled with a photoconvertible protein, Kaede.
00:10:54.07 To the left is the PALM super-resolution image,
00:10:58.10 and if we zoom up on that image we can see that,
00:11:02.05 with this technique,
00:11:03.20 you can decipher the distribution
00:11:06.26 of these individual 50 nm beads.
00:11:10.04 Now, of course many people
00:11:12.11 want to move into cells,
00:11:14.07 and it's possible to do this type of super-resolution imaging
00:11:17.03 in fixed cells
00:11:18.19 that have been plated on a coverslip.
00:11:21.04 Now, I mentioned
00:11:22.05 we use total internal reflection microscopy
00:11:25.10 to limit the imaging
00:11:27.07 to just about 100 nm off that coverslip
00:11:30.10 in order to avoid photons
00:11:35.07 that are being emitted by your probe
00:11:38.14 in other places in the cell,
00:11:40.06 and hence could interfere
00:11:42.17 with the signal that you're getting of the single molecules
00:11:45.12 that are of interest in this plane right here.
00:11:49.28 So just to give you some examples
00:11:51.29 of what you can get with this approach,
00:11:54.04 here are focal adhesions
00:11:55.17 tagged with a photoconvertible protein,
00:11:57.19 tandem-dimer Eos,
00:11:59.20 and if we zoom up on this you can see,
00:12:02.11 and I'll move over here,
00:12:04.00 the localization of these individual vinculin molecules
00:12:08.05 in these focal adhesions
00:12:09.26 that are found at the base of cells.
00:12:12.23 And these focal adhesions use,
00:12:14.06 are sort of like the feet of cells,
00:12:16.27 that allow cells to crawl.
00:12:20.29 This is another example of an Eos molecule
00:12:24.14 tagged to an ER resident protein,
00:12:27.00 the Reticulon1,
00:12:28.29 and if we zoom up on one element
00:12:31.08 of the endoplasmic reticulum,
00:12:32.22 you can see how these molecules
00:12:35.01 really outline the surface,
00:12:38.05 the individual tubular elements
00:12:41.05 that comprise this dense network of the ER.
00:12:46.18 Now, many organelles within cells
00:12:49.13 are not localized right within the 100 nm TIRF zone
00:12:53.25 of a cell that's put down on a coverslip,
00:12:58.07 and so there are various strategies
00:13:03.10 one can use to visualize intracellular compartments
00:13:07.09 using this super-resolution approach.
00:13:11.03 And one way is to fix cells
00:13:13.09 and section them as if for electron microscopy:
00:13:17.04 here, this cell has been sectioned,
00:13:18.28 this is about a 100 nm section,
00:13:21.28 that's going to then be placed on a coverslip
00:13:24.20 and imaged in that TIRF zone.
00:13:27.11 So this is a slice of the cell
00:13:29.01 that's expressing a photoactivable fluorescent protein,
00:13:32.22 and we're going to look at
00:13:34.14 what the organelles within that slice,
00:13:38.07 how molecules within those organelles distribute.
00:13:41.05 So here's one slice through a cell
00:13:43.24 expressing a mitochondrial matrix protein
00:13:47.04 tagged with the photoconvertible protein tandem-dimer Eos.
00:13:52.07 Now, the advantage of creating a thin section
00:13:56.14 through the cell
00:13:57.16 and doing PALM on that thin section
00:14:01.08 is that after you've imaged
00:14:04.18 the single molecule distribution
00:14:06.22 within that sample,
00:14:08.13 you can then take the sample
00:14:10.07 and put it in the electron microscope
00:14:12.26 to do transmission EM imaging
00:14:15.07 in order to compare the ultrastructure
00:14:18.21 of the structure of interest
00:14:21.29 to the distribution of the molecules.
00:14:24.22 And this is shown here for the mitochondria.
00:14:27.02 So this is the transmission EM of a mitochondria,
00:14:30.06 and this is the distribution
00:14:31.25 of the mitochondrial matrix protein within that.
00:14:36.12 And you can see that in this overlay here,
00:14:38.17 that they very nicely overlay,
00:14:41.14 and what this gives you is a high-density alternative
00:14:44.20 to conventional immunogold labeling approaches,
00:14:48.07 which typically, in a specimen like this,
00:14:50.22 where you're using antibodies tagged with immunogold,
00:14:55.02 would give you maybe 10 or 20 gold particles
00:14:58.15 to define the distribution of your protein.
00:15:01.00 Here, we're looking at 5,500 GFP,
00:15:05.15 the photoactivatable fluorescent protein tags/molecules
00:15:08.27 that have been resolved using the PALM technology.
00:15:16.01 Now, there are a variety
00:15:17.09 of photoactivatable fluorescent protein classes
00:15:21.03 that have emerged over the last four years.
00:15:24.27 The initial one was the photoactivatable GFP,
00:15:27.12 which switches from dark to green
00:15:29.24 and which has been used in a number of different techniques.
00:15:34.22 But more recently,
00:15:36.10 there's been a lot of excitement about these
00:15:39.02 photoconvertible proteins that start off green,
00:15:43.07 but in response to UV illumination,
00:15:46.00 change their emission spectrum
00:15:47.23 so that now they fluoresce red -
00:15:50.10 give off a red signal.
00:15:52.00 There's also reversible photoconverters
00:15:55.03 that can go from green to red,
00:15:58.25 and then back, from red to green.
00:16:01.16 So all of these classes of different photoactivable
00:16:04.27 or photoswitchable fluorescent proteins
00:16:07.00 allow us know to use them
00:16:10.06 for doing two color imaging
00:16:13.23 using this super-resolution approach.
00:16:16.16 And here's an example
00:16:17.26 where the photoactivatable GFP,
00:16:21.15 tagged to clathrin,
00:16:23.06 is being coexpressed
00:16:26.24 with a photoactivable mCherry
00:16:28.27 tagged to transferrin receptor.
00:16:31.20 Now, what this allows
00:16:33.13 is the simultaneous detection of these two molecules,
00:16:37.12 transferrin receptor and clathrin,
00:16:39.17 in a single cell,
00:16:41.13 simply by switching on with a UV laser pulse
00:16:45.03 either the mCherry, which gives you the red signal,
00:16:49.14 or the PAGFP, which gives you the green signal.
00:16:53.19 And what you can see in this super-resolution image
00:16:56.20 right down here,
00:16:57.25 is a codistribution of these two molecules
00:17:01.28 within densely packed structures
00:17:05.07 that we believe are clathrin-coated pits.
00:17:08.10 Clathrin-coated pits are known to be defined
00:17:10.22 by the activity of this clathrin coat protein,
00:17:14.02 and the transferrin receptor,
00:17:15.22 after binding transferrin,
00:17:18.00 is known to be endocytosed
00:17:21.00 within these clathrin-coated pits.
00:17:23.07 And we think that's what is being seen here
00:17:25.20 in this super-resolution imaging approach,
00:17:28.06 is the codistribution of these molecules in these coated pits.
00:17:34.18 Now, up to now,
00:17:36.23 I've showed examples
00:17:39.06 of using this single molecule localization approach
00:17:43.09 called PALM
00:17:44.21 for looking at specimens pretty much in 2D,
00:17:48.15 where we're putting them on a coverslip
00:17:52.09 and looking in TIRF.
00:17:54.13 But many questions that are important
00:17:57.07 for cell biology to address
00:18:01.08 require 3D information,
00:18:03.14 in terms of,
00:18:05.06 for a global view
00:18:07.13 of how these molecules are arranged
00:18:09.27 over 3D within cells.
00:18:12.28 And a very exciting new
00:18:17.09 advance with PALM
00:18:18.24 has come with this technique
00:18:21.09 called interferometric PALM, or iPALM.
00:18:25.02 And iPALM essentially couples
00:18:27.22 an interferometric strategy to PALM imaging,
00:18:32.07 so in this little QuickTime movie here,
00:18:35.06 this illustrates the basic principle of iPALM.
00:18:39.22 Essentially, a specimen
00:18:41.27 is being imaged by two different objectives,
00:18:45.20 and if you zoom up in here
00:18:47.14 what you can see is an individual
00:18:52.13 photoactivated molecule
00:18:53.26 that's giving off a photon.
00:18:56.05 Now, that photon distributes
00:18:57.25 as a wave in 360 degrees
00:19:01.05 and it's going to move into either
00:19:03.20 the top objective or the bottom objective
00:19:07.08 and then track through that objective
00:19:09.15 into this three-way beam splitter.
00:19:12.22 Now, depending on where the photon emitter
00:19:16.06 is positioned when it gives off its photon,
00:19:19.14 the waves from that photon,
00:19:23.17 when they recombine in this three-way beam splitter,
00:19:27.20 will either constructively or destructively interfere
00:19:30.24 with each other.
00:19:31.29 And that can be sensed by
00:19:35.03 these three CCD cameras
00:19:38.00 to determine, with nanometric accuracy,
00:19:41.29 where this photon has been emitted
00:19:45.29 in z space.
00:19:48.08 So this is the principle behind iPALM
00:19:50.12 and it gives remarkable 3D resolution.
00:19:54.17 So this is a resolution comparison
00:19:56.28 of confocal microscopy
00:19:59.01 in z and x-y,
00:20:01.16 compared to PALM,
00:20:03.13 where you get incredible improvement in your x-y,
00:20:07.13 and improvement in z based on the TIRF,
00:20:10.14 using total internal reflection microscopy.
00:20:13.22 What iPALM gives you is an additional improvement in z,
00:20:18.23 such that you now have an accuracy
00:20:20.23 of about 10 nm in this z dimension,
00:20:24.10 in terms of where a particular photon
00:20:28.11 emitted by a molecule is positioned.
00:20:32.21 So here's an example of iPALM imaging
00:20:36.14 of VSVG protein on the plasma membrane.
00:20:40.27 Now, what you're looking at,
00:20:42.15 all these little dots represent
00:20:44.10 single molecules of VSVG
00:20:47.14 that are localized on the plasma membrane.
00:20:50.28 Now, each of these molecules
00:20:52.21 have different colors associated with them
00:20:56.16 based on how far up
00:20:59.02 from the coverslip the molecule is positioned.
00:21:02.12 And this is a lookup table showing,
00:21:04.13 from 0-225 nm,
00:21:07.17 where these molecules are distributed in z space.
00:21:11.23 So if we take this little section,
00:21:14.07 this little rectangular area right here,
00:21:18.04 and rotate it on its side,
00:21:20.05 you can see in the side view
00:21:24.15 the surface of the plasma membrane.
00:21:27.07 You can see the dorsal
00:21:29.18 as well as the ventral surface of the plasma membrane,
00:21:32.22 which in this case is less than 200 nm apart.
00:21:38.03 So this is an extremely exciting approach
00:21:41.12 because it allows you, for the first time,
00:21:43.28 to get a 3-dimensional perspective
00:21:46.10 of the distribution of organelles
00:21:49.08 and membrane systems within cells.
00:21:52.01 So here's another example.
00:21:53.19 This is iPALM imaging
00:21:55.09 of the alpha-V integrin
00:21:57.02 that makes up the focal adhesion
00:21:59.23 which forms these little feet-like structures
00:22:02.15 at the bottom of cells.
00:22:04.19 Now, these feet-like structures
00:22:06.09 are shown in, are color-coded yellow here
00:22:10.03 only because they're positioned
00:22:11.24 very close to the plasma membrane.
00:22:14.09 What you're looking at here
00:22:15.27 is the distribution of thousands of molecules
00:22:19.13 that have been detected using PALM
00:22:23.26 and positioned in z based on this interferometric approach,
00:22:28.13 and color coded according to their z position.
00:22:31.15 Now, what's particularly interesting
00:22:33.21 is that you can see that different
00:22:37.07 positions of the molecule in z
00:22:40.03 have very different spatial organizations.
00:22:43.10 So for instance, the molecules that are color-coded purple and blue
00:22:47.03 are all found in structures that have this tubular-reticular pattern.
00:22:51.16 The reason is that these molecules
00:22:53.19 are within the endoplasmic reticulum,
00:22:56.01 which is positioned at about 225 nm
00:22:59.07 off the surface of cells.
00:23:01.18 The molecules that are color-coded yellow
00:23:04.13 are simply the ones positioned close to the coverslip,
00:23:08.04 and you can see all of those molecules
00:23:10.03 are associated in structures
00:23:12.12 that have the characteristic morphology
00:23:15.20 of focal adhesions.
00:23:17.18 So, if we take all of this information,
00:23:21.01 we can get a 3D perspective
00:23:23.27 on the distribution of this molecule integrin
00:23:27.11 as it passes through the entire secretory pathway:
00:23:30.22 we can see it in the ER,
00:23:32.17 on the plasma membrane,
00:23:33.21 and in these focal adhesions,
00:23:35.15 and we can get a super-resolution perspective
00:23:40.04 on how all of these membranes are organized within cells.
00:23:45.20 Now, up to now,
00:23:46.22 I've talked about how you can use PALM
00:23:50.11 in fixed specimens.
00:23:52.29 But you can also use these single molecule super-resolution approaches
00:23:57.12 in live cells,
00:23:59.06 and that's illustrated here,
00:24:00.27 in order to track the movement of individual molecules.
00:24:05.03 Now, I showed in the second part of this series
00:24:09.03 how, using photoactivation or photobleaching,
00:24:13.00 you could easily look at the diffusional behavior
00:24:15.29 of molecules
00:24:17.24 using diffraction-limited imaging.
00:24:20.04 But that approach
00:24:21.27 involves imaging large numbers of molecules,
00:24:25.00 large populations.
00:24:26.28 With single particle tracking PALM,
00:24:30.12 you can look at the behavior of individual molecules
00:24:33.26 and determine whether an individual molecule
00:24:36.07 is freely diffusing,
00:24:38.03 undergoing some type of active transport
00:24:40.05 as a result of the activity of a motor protein,
00:24:43.01 or undergoing some type of confinement.
00:24:45.20 And to illustrate that,
00:24:47.08 here we have the VSVG protein again,
00:24:49.19 at the cell surface,
00:24:51.29 and what you're looking at is the vector,
00:24:54.19 the tracks,
00:24:56.17 from these molecules
00:24:58.16 that have been detected
00:24:59.15 over the period of,
00:25:01.23 the lifetime of these photoactivatable fluorescent proteins.
00:25:05.09 And if you just look right here,
00:25:06.27 this is just a zoom-up showing the tracks
00:25:10.01 of individual VSVG molecules.
00:25:12.29 Each one of these different color lines
00:25:15.10 represents the track taken
00:25:17.18 by an individual VSVG molecule
00:25:19.24 at the cell surface.
00:25:22.20 Now, with these tracks,
00:25:24.23 you can do a lot of things.
00:25:26.22 So for instance,
00:25:28.28 here, the tracks have been translated
00:25:34.05 into a diffusion coefficient.
00:25:36.10 So, each one of these little spots
00:25:38.09 represents the diffusion coefficient
00:25:41.06 of an individual molecule
00:25:43.02 that originated at that spot.
00:25:45.11 And this lookup table, here,
00:25:46.28 just shows what that diffusion coefficient was.
00:25:50.21 Now, what you can see from this
00:25:53.05 is that there are subsets of these molecules,
00:25:55.27 in this case VSVG,
00:25:57.26 that are highly mobile,
00:25:59.13 and then there are subsets that are less mobile.
00:26:02.06 And this gives you a spatial sense
00:26:05.15 of where those molecules are distributed
00:26:08.05 -- ones that move fast versus slow --
00:26:10.12 across the surface of the cell.
00:26:12.25 Now, as a comparison,
00:26:14.28 this is the HIV Gag protein
00:26:18.21 which has been mapped.
00:26:20.15 The HIV Gag protein
00:26:22.20 is a key component of the
00:26:26.21 HIV virus that is responsible for AIDS.
00:26:30.24 And, when you express a photoactivatable form of this virus,
00:26:35.03 you can then map its behavior
00:26:37.13 on the cell surface,
00:26:40.01 a photoactivatable form
00:26:41.15 of the HIV Gag protein
00:26:43.24 that forms the coat of this virus.
00:26:45.12 You then can map its distribution on the cell surface of the cell,
00:26:48.17 and what you see is that these molecules,
00:26:51.23 by and large,
00:26:52.26 are not moving as rapidly as the VSVG.
00:26:57.06 Large numbers of these molecules
00:26:59.11 have very low diffusion coefficients,
00:27:01.16 as illustrated in this lookup table here,
00:27:04.00 and many of the molecules
00:27:05.12 are clustered in these aggregates.
00:27:09.02 We think these clusters represent sites of viral budding
00:27:12.02 on the surface of the cell
00:27:13.16 and we're hoping that, using this technique,
00:27:16.04 we can get insight into how the virus budding process occurs,
00:27:21.13 vis-a-vis the assembly of these proteins
00:27:24.23 that form the coat of this virus.
00:27:28.21 Now finally, with the single particle tracking PALM,
00:27:32.25 where you're looking in living cells
00:27:35.15 at the behavior of single molecules,
00:27:38.18 you can go off the cell surface
00:27:40.24 and into the cell to look
00:27:42.10 at the behavior of cytoskeletal components.
00:27:45.13 And here's an example where we've been imaging
00:27:49.12 actin filaments using a photoactivatable
00:27:53.08 fluorescently tagged actin molecule.
00:27:55.07 So this is a living cell,
00:27:56.20 and you're just tracking the movements
00:27:59.09 of individual actin molecules.
00:28:02.18 Because the actin molecules that are part of filaments
00:28:05.22 are moving relatively slow
00:28:08.03 compared to actin that's free in the cytoplasm,
00:28:12.05 you can actually track the behavior
00:28:15.01 of individual actin molecules
00:28:16.26 within that filament.
00:28:18.06 And this is just a zoom-up of a portion of the periphery of the cell
00:28:22.11 showing the behavior of the actin molecules there,
00:28:25.06 and you can see that all of these molecules are moving,
00:28:27.29 and they're moving in a directed fashion,
00:28:30.10 a fashion where the molecules are moving inward
00:28:32.26 along tracks of actin filaments
00:28:36.13 that are undergoing retrograde actin flow.
00:28:39.26 And using this approach,
00:28:41.12 we and others are finding some new aspects of this movement,
00:28:47.00 because of the ability to image single molecules.
00:28:52.01 So, what all this means
00:28:53.27 is that there are tremendous possibilities
00:28:56.27 available for researchers now,
00:28:58.29 for addressing questions
00:29:00.29 that really have been off limits up to now,
00:29:04.21 because they involve imaging individual molecules.
00:29:09.23 So with these techniques that involve
00:29:11.14 single molecule localization, like PALM,
00:29:14.04 you have now the ability to go in
00:29:16.08 and map out distributions of molecules
00:29:19.17 within nanometric structures
00:29:22.07 as well as the dynamic movements
00:29:24.15 of these molecules
00:29:26.10 through this type of tracking.

  • Part 1: Intracellular Fluorescent Imaging: An Introduction


Watch the video: Τα ποιο χρήσιμα συμπληρώματα στο Bodybuilding (January 2022).