Information

How is Glycophorin A and straphylococcal related to Escherichia coli and what does readily purified mean in this context?


I am reviewing the paper "Glycophorin A Dimerization Is Driven by Specific Interactions between Transmembrane Alpha-Helices." There is a statement in the abstract which I don't understand:

"The transmembrane alpha-helical domain of interest is fused to the C-terminus of staphylococcal nuclease. The resulting chimera can be expressed at high levels in Escherichia coli and is readily purified."

As I understand it, this describes that an alpha-helix within Glycophorin A is fused to straphylococcal nuclease? Then, how does Escherichia coli come into the discussion and what is meant by being readily purified?


Basically, they engineered a vector which, when transfected to E. coli, produces transcripts of -and thus proteins to- a fusion gene which produces these transmembrane α helices conjugated to the staphylococcal nuclease. In other words, the E. coli are just factories for producing proteins:

Expression, Extraction, and Purification of SN/GpA - For high levels of SN/GpA production, pT7SN/GpA was transformed into E. coli MGT7 (kindly provided by D. LeMaster), containing the plasmid pLYS-S.

And the reasoning therein was proposed in the discussion,

We report here the use of a chimeric protein to show that the presence of just the transmembrane domain of GpA, fused to a normally monomeric soluble protein, is sufficient to mediate the dimerization of this artificial membrane protein -in SDS

What they mean by readily purified is that the protein can be extracted relatively easily, and in the experimental method they explain some commonplace methods of purification:

One-step purification of milligram quantities of SN/GpA from the extract could be achieved by reversed-phase HPLC utilizing an acetonitrile/isopropyl alcohol/water gradient on a semipreparative Vydac C4 column. Alternatively, purification of larger quantities was achieved using two rounds of cation-exchange chromatography…

… The chimera SN/GpA131, but not truncated forms, could alterNaCl, 50 mM Tris-HC1, 5 mM EDTA, 1 mM PMSF, 0.025% NaNa, natively be extracted by sonication of the pellet after cell lysis in 1 M pH 7.9, containing no detergent. This extraction was of similar efficiency to that with Lubrol, and was utilized in the preparation of material for generation of transmembrane peptide by trypsin treatment.


Download and print this article for your personal scholarly, research, and educational use.

Buy a single issue of Science for just $15 USD.

Science Translational Medicine

Vol 6, Issue 247
30 July 2014

Article Tools

Please log in to add an alert for this article.

By Faith H. Osier , Margaret J. Mackinnon , Cécile Crosnier , Gregory Fegan , Gathoni Kamuyu , Madushi Wanaguru , Edna Ogada , Brian McDade , Julian C. Rayner , Gavin J. Wright , Kevin Marsh

Science Translational Medicine 30 Jul 2014 : 247ra102

Uncharacterized proteins from the merozoite stage of Plasmodium falciparum provide new antigens for malaria blood-stage vaccine development.


Introduction

Investigations into mechanisms that control gene expression in mammals have focused largely on transcription and, to a lesser degree, post-transcriptional events related to the fate of specific mRNAs and their cellular localization. Nevertheless, increasing biochemical evidence points to another level of regulation during somatic and germ cell differentiation, namely translational control. Translational regulation can be achieved either by modifying the concentrations or activities of general translational factors ( Mathews et al., 2000 ) or in an mRNA-specific manner, dependent upon the interaction of trans-acting factors with cis-acting sequences present on the mRNA ( Rouault and Harford, 2000 ).

Phosphorylation of the α-subunit of translational initiation factor 2 (eIF2α) has been recognized as a key mechanism of global inhibition of translational initiation. eIF2 is a general translational initiation factor composed of three subunits: α, β and γ. eIF2 forms two types of binary complexes: active eIF2⋅GTP and inactive eIF2⋅GDP. eIF2⋅GTP binds Met-tRNAi to form a ternary complex that is required for binding to the 40S subunit of ribosome and mRNA. Subsequently, upon joining of the 60S subunit, GTP from eIF2⋅GTP is hydrolyzed to GDP. In order to recycle to its active form and bind another Met-tRNAi, eIF2⋅GDP must be converted to eIF2⋅GTP through a guanylate exchange reaction catalyzed by eIF2B. eIF2 has a 400-fold greater affinity for GDP than for GTP. The exchange of tightly bound GDP for GTP requires eIF2B, which is in limiting concentrations and present at 15–25% of the amount of eIF2 ( Trachsel, 1996 ).

The recycling of eIF2 is inhibited by phosphorylation of its α-subunit. Phosphorylation of the α-subunit of eIF2 at Ser51 is carried out by a family of eIF2α kinases. Phosphorylated eIF2 (αP)⋅GDP binds much more tightly to the regulatory sub-complex of eIF2B than eIF2⋅GDP and prevents the GDP—GTP exchange activity of eIF2B ( Krishnamoorthy et al., 2001 ). Thus, once the amount of phosphorylated eIF2 exceeds the amount of eIF2B, protein synthesis is shut off.

Four eIF2α kinases have been identified in mammals: the double-stranded RNA-dependent eIF2α kinase (PKR), the mammalian ortholog of the yeast GCN2 protein kinase, the endoplasmic reticulum (ER) resident kinase (PERK) and heme-regulated eIF2α kinase (HRI). These eIF2α kinases share extensive homology in their kinase catalytic domains ( Meurs et al., 1990 Chen et al., 1991 Ramirez et al., 1991 Berlanga et al., 1998 Shi et al., 1998 Harding et al., 1999 ). Although they all inhibit protein synthesis by phosphorylation of eIF2α, it is predicted that a differential physiological response may be produced as a consequence of their tissue distributions and the signals to which they respond. PKR is induced by interferon and regulated by dsRNA through two N-terminal dsRNA-binding domains ( Kaufman, 2000 ). GCN2 is highly expressed in the liver and brain ( Berlanga et al., 1999 Sood et al., 2000 ) and is activated under conditions of amino acid starvation through the C-terminal domain, which contains a His-tRNA synthase-like sequence ( Hinnebusch, 1996 ). PERK is highly expressed in secretory tissues, particularly the pancreas, and is activated by ER stress. PERK contains a luminal domain that is similar to the sensor domain of the ER-stress kinase Irel ( Ron, 2000 ). HRI is expressed predominantly in erythroid cells and is regulated by heme, the prosthetic group of hemoglobin, through the two heme-binding domains located in the N-terminus and the kinase insertion ( Chen, 2000 ).

HRI has been extensively studied biochemically. It is well documented that protein synthesis in intact reticulocytes and their lysates is dependent upon the availability of heme. In heme deficiency, inhibition of protein synthesis correlates with the activation of HRI ( Clemens, 1996 Chen, 2000 ). Expression of HRI in insect Sf9 cells causes global inhibition of protein synthesis. In addition, baculovirus-expressed HRI is a hemoprotein whose activity is regulated by micromolar concentrations of hemin, both in vitro and in vivo ( Chefalo et al., 1994 , 1998 ). HRI contains two distinct heme-binding sites. Heme bound to the N-terminal domain is stable and co-purifies with HRI to homogeneity. In contrast, heme binds to the kinase insertion domain reversibly and inhibits HRI kinase activity upon binding, thereby regulating HRI activity according to intracellular heme concentrations ( Chefalo et al., 1998 Rafie-Kolpin et al., 2000 ). HRI protein, activity and mRNA are detected predominantly in red blood cell (RBC) precursors, and HRI mRNA levels increase during erythroid differentiation of mouse erythroleukemic (MEL) cells ( Crosby et al., 1994 ). Small amounts of HRI mRNA are also found in non-erythroid tissues but no evidence of HRI protein expression has been reported ( Mellor et al., 1994 Berlanga et al., 1998 ).

In order to elucidate the physiological role of HRI, in the context of a whole animal, we disrupted the HRI gene in mouse embryonic stem (ES) cells. HRI −/− mice appear to be normal, are fertile and present no gross abnormality of hematological parameters. However, in iron deficiency, the adaptive response of wild-type (wt) mice, characterized by RBC hypochromia and microcytosis, was dramatically altered. In HRI −/− mice, RBC size remained normal with hyperchromic rather than hypochromic anemia. Globins devoid of heme aggregated as inclusions within the RBC and its precursors, resulting in anemia with compensatory erythroid hyperplasia and accelerated apoptosis of erythroid precursors in bone marrow and spleen. Together, these results establish the physiological role of HRI in balancing the synthesis of α- and β-globins with the availability of heme in RBC precursors. Furthermore, this translational regulation of HRI in iron deficiency is necessary for the survival of erythroid precursors.


Gary Schoolnik

Medicine - Infectious Diseases

Clinical Focus

Academic Appointments

Professional Education

Contact

Additional Info

Current Research and Scholarly Interests

Structure-function analysis of bacterial adhesion proteins and toxins design and synthesis of synthetic antigens immunobiology of human papillomaviruses

2020-21 Courses

    Independent Studies (14)

      EARTHSYS 297 (Aut, Win, Spr)
      ENVRES 398 (Aut, Win, Spr, Sum)
      MED 299 (Aut, Win, Spr, Sum)
      MI 299 (Win, Spr)
      EARTHSYS 250 (Aut, Win, Spr)
      ENVRES 399 (Aut, Win, Spr, Sum)
      MED 280 (Aut, Win, Spr, Sum)
      MED 399 (Aut, Win, Spr, Sum)
      MI 399 (Win, Spr)
      EARTHSYS 199 (Aut)
      MED 370 (Aut, Win, Spr, Sum)
      MI 370 (Win, Spr)
      MED 199 (Aut, Win, Spr, Sum)
      MI 199 (Win, Spr)

    All Publications

    • The competitive cost of antibiotic resistance in Mycobacterium tuberculosis SCIENCE Gagneux, S., Long, C. D., Small, P. M., Van, T., Schoolnik, G. K., Bohannan, B. J. 2006 312 (5782) : 1944-1946

    Abstract

    Mathematical models predict that the future of the multidrug-resistant tuberculosis epidemic will depend on the fitness cost of drug resistance. We show that in laboratory-derived mutants of Mycobacterium tuberculosis, rifampin resistance is universally associated with a competitive fitness cost and that this cost is determined by the specific resistance mutation and strain genetic background. In contrast, we demonstrate that prolonged patient treatment can result in multidrug-resistant strains with no fitness defect and that strains with low- or no-cost resistance mutations are also the most frequent among clinical isolates.

    Abstract

    It has recently become feasible to quantify all mRNAs encoded by the genomes of bacterial pathogens and their eukaryotic host cells and to apply this approach to study the interaction of Mycobacterium tuberculosis with its primary host cell, the macrophage. These studies helped to identify regulatory circuits which mediate adaptation of the M. tuberculosis transcriptome to intraphagosomal environments and stimulated hypotheses for the function of these circuits in human tuberculosis. The macrophage transcriptome reacts to infections with the induction of a pathogen-unspecific expression program as well as the induction of pathogen-specific expression signatures, both of which contribute to the immunologic activation of the infected cell. M. tuberculosis induced changes in the macrophage transcriptome are mediated by Toll-like receptor dependent and Toll-like receptor independent signal transduction pathways. This response is shaped by macrophage produced reactive nitrogen and oxygen molecules and affected by viability and virulence of the pathogen.

    Abstract

    Phase variation between smooth and rugose colony variants of Vibrio cholerae is predicted to be important for the pathogen's survival in its natural aquatic ecosystems. The rugose variant forms corrugated colonies, exhibits increased levels of resistance to osmotic, acid, and oxidative stresses, and has an enhanced capacity to form biofilms. Many of these phenotypes are mediated in part by increased production of an exopolysaccharide termed VPS. In this study, we compared total protein profiles of the smooth and rugose variants using two-dimensional gel electrophoresis and identified one protein that is present at a higher level in the rugose variant. A mutation in the gene encoding this protein, which does not have any known homologs in the protein databases, causes cells to form biofilms that are more fragile and sensitive to sodium dodecyl sulfate than wild-type biofilms. The results indicate that the gene, termed rbmA (rugosity and biofilm structure modulator A), is required for rugose colony formation and biofilm structure integrity in V. cholerae. Transcription of rbmA is positively regulated by the response regulator VpsR but not VpsT.

    Abstract

    Vibrio cholerae, the etiological agent of the diarrheal illness cholera, can kill an infected adult in 24 h. V.cholerae lives as an autochthonous microbe in estuaries, rivers and coastal waters. A better understanding of its metabolic pathways will assist the development of more effective treatments and will provide a deeper understanding of how this bacterium persists in natural aquatic habitats. Using the completed V.cholerae genome sequence and PathoLogic software, we created VchoCyc, a pathway-genome database that predicted 171 likely metabolic pathways in the bacterium. We report here experimental evidence supporting the computationally predicted pathways. The evidence comes from microarray gene expression studies of V.cholerae in the stools of three cholera patients [D. S. Merrell, S. M. Butler, F. Qadri, N. A. Dolganov, A. Alam, M. B. Cohen, S. B. Calderwood, G. K. Schoolnik and A. Camilli (2002) Nature, 417, 642-645.], from gene expression studies in minimal growth conditions and LB rich medium, and from clinical tests that identify V.cholerae. Expression data provide evidence supporting 92 (53%) of the 171 pathways. The clinical tests provide evidence supporting seven pathways, with six pathways supported by both methods. VchoCyc provides biologists with a useful tool for analyzing this organism's metabolic and genomic information, which could lead to potential insights into new anti-bacterial agents. VchoCyc is available in the BioCyc database collection (http://BioCyc.org).

    Abstract

    The mosaic-structured Vibrio cholerae genome points to the importance of horizontal gene transfer (HGT) in the evolution of this human pathogen. We showed that V. cholerae can acquire new genetic material by natural transformation during growth on chitin, a biopolymer that is abundant in aquatic habitats (e.g., from crustacean exoskeletons), where it lives as an autochthonous microbe. Transformation competence was found to require a type IV pilus assembly complex, a putative DNA binding protein, and three convergent regulatory cascades, which are activated by chitin, increasing cell density, and nutrient limitation, a decline in growth rate, or stress.

    Abstract

    Chemotherapeutic options to treat tuberculosis are severely restricted by the intrinsic resistance of Mycobacterium tuberculosis to the majority of clinically applied antibiotics. Such resistance is partially provided by the low permeability of their unique cell envelope. Here we describe a complementary system that coordinates resistance to drugs that have penetrated the envelope, allowing mycobacteria to tolerate diverse classes of antibiotics that inhibit cytoplasmic targets. This system depends on whiB7, a gene that pathogenic Mycobacterium shares with Streptomyces, a phylogenetically related genus known as the source of diverse antibiotics. In M. tuberculosis, whiB7 is induced by subinhibitory concentrations of antibiotics (erythromycin, tetracycline, and streptomycin) and whiB7 null mutants (Streptomyces and Mycobacterium) are hypersusceptible to antibiotics in vitro. M. tuberculosis is also antibiotic sensitive within a monocyte model system. In addition to antibiotics, whiB7 is induced by exposure to fatty acids that pathogenic Mycobacterium species may accumulate internally or encounter within eukaryotic hosts during infection. Gene expression profiling analyses demonstrate that whiB7 transcription determines drug resistance by activating expression of a regulon including genes involved in ribosomal protection and antibiotic efflux. Components of the whiB7 system may serve as attractive targets for the identification of inhibitors that render M. tuberculosis or multidrug-resistant derivatives more antibiotic-sensitive.

    Abstract

    Reversible phase variation between the rugose and smooth colony variants is predicted to be important for the survival of Vibrio cholerae in natural aquatic habitats. Microarray expression profiling studies of the rugose and smooth variants of the same strain led to the identification of 124 differentially regulated genes. Further expression profiling experiments showed how these genes are regulated by the VpsR and HapR transcription factors, which, respectively, positively and negatively regulate production of VPS(El Tor), a rugose-associated extracellular polysaccharide. The study of mutants of rpoN and rpoS demonstrated the effects of these alternative sigma factors on phase variation-specific gene expression. Bioinformatics analysis of these expression data shows that 'rugosity' and 'smoothness' are determined by a complex hierarchy of positive and negative regulators, which also affect the biofilm, surface hydrophobicity and motility phenotypes of the organism.

    Abstract

    Chitin, an insoluble polymer of GlcNAc, is an abundant source of carbon, nitrogen, and energy for marine microorganisms. Microarray expression profiling and mutational studies of Vibrio cholerae growing on a natural chitin surface, or with the soluble chitin oligosaccharides (GlcNAc)(2-6), GlcNAc, or the glucosamine dimer (GlcN)2 identified three sets of differentially regulated genes. We show that (i) ChiS, a sensor histidine kinase, regulates expression of the (GlcNAc)(2-6) gene set, including a (GlcNAc)2 catabolic operon, two extracellular chitinases, a chitoporin, and a PilA-containing type IV pilus, designated ChiRP (chitin-regulated pilus) that confers a significant growth advantage to V. cholerae on a chitin surface (ii) GlcNAc causes the coordinate expression of genes involved with chitin chemotaxis and adherence and with the transport and assimilation of GlcNAc (iii) (GlcN)2 induces genes required for the transport and catabolism of nonacetylated chitin residues and (iv) the constitutively expressed MSHA pilus facilitates adhesion to the chitin surface independent of surface chemistry. Collectively, these results provide a global portrait of a complex, multistage V. cholerae program for the efficient utilization of chitin.

    Abstract

    The innate mechanisms used by Mycobacterium tuberculosis to persist during periods of non-proliferation are central to understanding the physiology of the bacilli during latent disease. We have used whole genome expression profiling to expose adaptive mechanisms initiated by M. tuberculosis in two common models of M. tuberculosis non-proliferation. The first of these models was a standard growth curve in which gene expression changes were followed from exponential growth through the transition to stationary phase. In the second model, we followed the adaptive process of M. tuberculosis during transition from aerobic growth to a state of anaerobic non-replicating persistence. The most striking finding from these experiments was the strong induction of the entire DosR "dormancy" regulon over approximately 20 days during the long transition to an anaerobic state. This is contrasted by the muted overall response to aerated stationary phase with only a partial dormancy regulon response. From the results presented here we conclude that the respiration-limited environment of the oxygen-depleted NRP model recreates at least one fundamental factor for which the genome of M. tuberculosis encodes a decisive adaptive program.

    Abstract

    The genome of Mycobacterium tuberculosis encodes approximately 170 members of the unique mycobacterial PE and PPE gene families. Evidence suggests members of these families are surface-associated cell wall proteins that may provide a diverse antigenic profile and affect immunity. To determine if the expression patterns of PE/PPE genes are consistent with a role in antigenic variability, we analyzed microarray data from 132 experimental conditions for expression of PE/PPE genes. Whole genome expression patterns show that the PE/PPE genes are regulated in a variable and largely independent manner. Gene expression profiling of 15 unique conditions identified differential regulation of 128 of the 169 PE/PPE genes. Expression of the PE/PPE genes appears to be controlled by a variety of independent mechanisms. These data indicate that differential expression of the PE/PPE genes has the potential to provide a dynamic antigenic profile during the course of changing microenvironments within the host.

    Abstract

    The type IV bundle-forming pili (BFP) of enteropathogenic Escherichia coli (EPEC) are required for virulence in orally challenged human volunteers and for the localized adherence and autoaggregation in vitro phenotypes. BFP filament biogenesis and function are encoded by the 14-gene bfp operon. The BFP assembly complex, containing a BfpB-His6 fusion protein, was chemically cross-linked in situ, and the complex was then purified from BFP-expressing EPEC by a combination of nickel- and BfpB antibody-based affinity chromatography. Characterization of the isolated complex by immunoblotting using BFP protein-specific antibodies showed that at least 10 of the 14 proteins specified by the bfp operon physically interact to form an oligomeric complex. Proteins localized to the outer membrane, inner membrane, and periplasm are within this complex, thus demonstrating that the complex spans the periplasmic space. A combination of immunofluorescence and immuno-gold thin-section transmission electron microscopy studies localized this complex to one pole of the cell.

    Abstract

    Macrophages are activated from a resting state by a combination of cytokines and microbial products. Microbes are often sensed through Toll-like receptors signaling through MyD88. We used large-scale microarrays in multiple replicate experiments followed by stringent statistical analysis to compare gene expression in wild-type (WT) and MyD88-/- macrophages. We confirmed key results by quantitative reverse transcription polymerase chain reaction, Western blot, and enzyme-linked immunosorbent assay. Surprisingly, many genes, such as inducible nitric oxide synthase, IRG-1, IP-10, MIG, RANTES, and interleukin 6 were induced by interferon (IFN)-gamma from 5- to 100-fold less extensively in MyD88-/- macrophages than in WT macrophages. Thus, widespread, full-scale activation of macrophages by IFN-gamma requires MyD88. Analysis of the mechanism revealed that MyD88 mediates a process of self-priming by which resting macrophages produce a low level of tumor necrosis factor. This and other factors lead to basal activation of nuclear factor kappaB, which synergizes with IFN-gamma for gene induction. In contrast, infection by live, virulent Mycobacterium tuberculosis (Mtb) activated macrophages largely through MyD88-independent pathways, and macrophages did not need MyD88 to kill Mtb in vitro. Thus, MyD88 plays a dynamic role in resting macrophages that supports IFN-gamma-dependent activation, whereas macrophages can respond to a complex microbial stimulus, the tubercle bacillus, chiefly by other routes.

    Abstract

    The predominant mode of HIV transmission worldwide is via heterosexual contact, with the cervico-vaginal mucosa being the main portal of entry in women. The cervico-vaginal mucosa is naturally colonized with commensal bacteria, primarily lactobacilli. To address the urgent need for female-controlled approaches to block the heterosexual transmission of HIV, we have engineered natural human vaginal isolates of Lactobacillus jensenii to secrete two-domain CD4 (2D CD4) proteins. The secreted 2D CD4 recognized a conformation-dependent anti-CD4 antibody and bound HIV type 1 (HIV-1) gp120, suggesting that the expressed proteins adopted a native conformation. Single-cycle infection assays using HIV-1HxB2 carrying a luciferase reporter gene demonstrated that Lactobacillus-derived 2D CD4 inhibited HIV-1 entry into target cells in a dose-dependent manner. Importantly, coincubation of the engineered bacteria with recombinant HIV-1HxB2 reporter virus led to a significant decrease in virus infectivity of HeLa cells expressing CD4-CXCR4-CCR5. Engineered lactobacilli also caused a modest, but statistically significant, decrease in infectivity of a primary isolate, HIV-1JR-FL. This represents an important first step toward the development of engineered commensal bacteria within the vaginal microflora to inhibit heterosexual transmission of HIV.

    Abstract

    Little is known about the biochemical environment in phagosomes harboring an infectious agent. To assess the state of this organelle we captured the transcriptional responses of Mycobacterium tuberculosis (MTB) in macrophages from wild-type and nitric oxide (NO) synthase 2-deficient mice before and after immunologic activation. The intraphagosomal transcriptome was compared with the transcriptome of MTB in standard broth culture and during growth in diverse conditions designed to simulate features of the phagosomal environment. Genes expressed differentially as a consequence of intraphagosomal residence included an interferon gamma- and NO-induced response that intensifies an iron-scavenging program, converts the microbe from aerobic to anaerobic respiration, and induces a dormancy regulon. Induction of genes involved in the activation and beta-oxidation of fatty acids indicated that fatty acids furnish carbon and energy. Induction of sigmaE-dependent, sodium dodecyl sulfate-regulated genes and genes involved in mycolic acid modification pointed to damage and repair of the cell envelope. Sentinel genes within the intraphagosomal transcriptome were induced similarly by MTB in the lungs of mice. The microbial transcriptome thus served as a bioprobe of the MTB phagosomal environment, showing it to be nitrosative, oxidative, functionally hypoxic, carbohydrate poor, and capable of perturbing the pathogen's cell envelope.

    Abstract

    An estimated two billion persons are latently infected with Mycobacterium tuberculosis. The host factors that initiate and maintain this latent state and the mechanisms by which M. tuberculosis survives within latent lesions are compelling but unanswered questions. One such host factor may be nitric oxide (NO), a product of activated macrophages that exhibits antimycobacterial properties. Evidence for the possible significance of NO comes from murine models of tuberculosis showing progressive infection in animals unable to produce the inducible isoform of NO synthase and in animals treated with a NO synthase inhibitor. Here, we show that O2 and low, nontoxic concentrations of NO competitively modulate the expression of a 48-gene regulon, which is expressed in vivo and prepares bacilli for survival during long periods of in vitro dormancy. NO was found to reversibly inhibit aerobic respiration and growth. A heme-containing enzyme, possibly the terminal oxidase in the respiratory pathway, likely senses and integrates NO and O2 levels and signals the regulon. These data lead to a model postulating that, within granulomas, inhibition of respiration by NO production and O2 limitation constrains M. tuberculosis replication rates in persons with latent tuberculosis.

    Abstract

    Distinct morphological changes associated with the complex development cycle of the obligate intracellular bacterial pathogen Chlamydia trachomatis have been historically well characterized by microscopy. A number of temporally regulated genes have been characterized previously, suggesting that the chlamydial developmental cycle is regulated at the transcriptional level. This hypothesis was tested by microarray analysis in which the entire C. trachomatis genome was analyzed, providing a comprehensive assessment of global gene regulation throughout the chlamydial developmental cycle. Seven temporally cohesive gene clusters were identified, with 22% (189 genes) of the genome differentially expressed during the developmental cycle. The correlation of these gene clusters with hallmark morphological events of the chlamydial developmental cycle suggests three global stage-specific networks of gene regulation.

    Abstract

    Unlike many pathogens that are overtly harmful to their hosts, Mycobacterium tuberculosis can persist for years within humans in a clinically latent state. Latency is often linked to hypoxic conditions within the host. Among M. tuberculosis genes induced by hypoxia is a putative transcription factor, Rv3133c/DosR. We performed targeted disruption of this locus followed by transcriptome analysis of wild-type and mutant bacilli. Nearly all the genes powerfully regulated by hypoxia require Rv3133c/DosR for their induction. Computer analysis identified a consensus motif, a variant of which is located upstream of nearly all M. tuberculosis genes rapidly induced by hypoxia. Further, Rv3133c/DosR binds to the two copies of this motif upstream of the hypoxic response gene alpha-crystallin. Mutations within the binding sites abolish both Rv3133c/DosR binding as well as hypoxic induction of a downstream reporter gene. Also, mutation experiments with Rv3133c/DosR confirmed sequence-based predictions that the C-terminus is responsible for DNA binding and that the aspartate at position 54 is essential for function. Together, these results demonstrate that Rv3133c/DosR is a transcription factor of the two-component response regulator class, and that it is the primary mediator of a hypoxic signal within M. tuberculosis.

    Abstract

    The bacterial transcriptome is a dynamic entity that reflects the organism's immediate, ongoing and genome-wide response to its environment. Microarray expression profiling provides a comprehensive portrait of the transcriptional world enabling us to view the organism as a 'system' that is more than the sum of its parts. The vigilance of microorganisms to environmental change, the alacrity of the transcriptional response, the short half-life of bacterial mRNA and the genome-scale nature of the investigation collectively explain the power of this method. These same features pose the most significant experimental design and execution issues which, unless surmounted, predictably generate a distorted image of the transcriptome. Conversely, the expression profile of a properly conceived and conducted microarray experiment can be used for hypothesis testing: disclosure of the metabolic and biosynthetic pathways that underlie adaptation of the organism to chang-ing conditions of growth the identification of co-ordinately regulated genes the regulatory circuits and signal transduction systems that mediate the adaptive response and temporal features of developmental programmes. The study of bacterial pathogenesis by microarray expression profiling poses special challenges and opportunities. Although the technical hurdles are many, obtaining expression profiles of an organism growing in tissue will probably reveal strategies for growth and survival in the host's microenvironment. Identifying these colonization strategies and their cognate expression patterns involves a 'deconstruction' process that combines bioinformatics analysis and in vitro DNA array experimentation.

    Abstract

    The mycobacterial IdeR protein is a metal-dependent regulator of the DtxR (diphtheria toxin repressor) family. In the presence of iron, it binds to a specific DNA sequence in the promoter regions of the genes that it regulates, thus controlling their transcription. In this study, we provide evidence that ideR is an essential gene in Mycobacterium tuberculosis. ideR cannot normally be disrupted in this mycobacterium in the absence of a second functional copy of the gene. However, a rare ideR mutant was obtained in which the lethal effects of ideR inactivation were alleviated by a second-site suppressor mutation and which exhibited restricted iron assimilation capacity. Studies of this strain and a derivative in which IdeR expression was restored allowed us to identify phenotypic effects resulting from ideR inactivation. Using DNA microarrays, the iron-dependent transcriptional profiles of the wild-type, ideR mutant, and ideR-complemented mutant strains were analyzed, and the genes regulated by iron and IdeR were identified. These genes encode a variety of proteins, including putative transporters, proteins involved in siderophore synthesis and iron storage, members of the PE/PPE family, a membrane protein involved in virulence, transcriptional regulators, and enzymes involved in lipid metabolism.

    Abstract

    Like other bacterial species, Mycobacterium tuberculosis has multiple sigma (sigma) factors encoded in its genome. In previously published work, we and others have shown that mutations in some of these transcriptional activators render M. tuberculosis sensitive to various environmental stresses and, in some cases, cause attenuated virulence phenotypes. In this paper, we characterize a M. tuberculosis mutant lacking the ECF sigma factor sigma(H). This mutant was more sensitive than the wild type to heat shock and to various oxidative stresses, but did not show decreased ability to grow inside macrophages. Using quantitative reverse transcription-PCR and microarray technology, we have started to define the sigma(H) regulon and its involvement in the global regulation of the response to heat shock and the thiol-specific oxidizing agent diamide. We identified 48 genes whose expression increased after exposure of M. tuberculosis to diamide out of these, 39 were not induced in the sigH mutant, showing their direct or indirect dependence on sigma(H). Some of these genes encode proteins whose predicted function is related to thiol metabolism, such as thioredoxin, thioredoxin reductase and enzymes involved in cysteine and molybdopterine biosynthesis. Other genes under sigma(H) control encode transcriptional regulators such as sigB, sigE, and sigH itself.

    Abstract

    Production of type IV bundle-forming pili (BFP) by enteropathogenic Escherichia coli (EPEC) requires the protein products of 12 genes of the 14-gene bfp operon. Antisera against each of these proteins were used to demonstrate that in-frame deletion of individual genes within the operon reduces the abundance of other bfp operon-encoded proteins. This result was demonstrated not to be due to downstream polar effects of the mutations but rather was taken as evidence for protein-protein interactions and their role in the stabilization of the BFP assembly complex. These data, combined with the results of cell compartment localization studies, suggest that pilus formation requires the presence of a topographically discrete assembly complex that is composed of BFP proteins in stoichiometric amounts. The assembly complex appears to consist of an inner membrane component containing three processed, pilin-like proteins, BfpI, -J, and -K, that localize with BfpE, -L, and -A (the major pilin subunit) an outer membrane, secretin-like component, BfpB and -G and a periplasmic component composed of BfpU. Of these, only BfpL consistently localizes with both the inner and outer membranes and thus, together with BfpU, may articulate between the Bfp proteins in the inner membrane and outer membrane compartments.

    Abstract

    The factors that enhance the transmission of pathogens during epidemic spread are ill defined. Water-borne spread of the diarrhoeal disease cholera occurs rapidly in nature, whereas infection of human volunteers with bacteria grown in vitro is difficult in the absence of stomach acid buffering. It is unclear, however, whether stomach acidity is a principal factor contributing to epidemic spread. Here we report that characterization of Vibrio cholerae from human stools supports a model whereby human colonization creates a hyperinfectious bacterial state that is maintained after dissemination and that may contribute to epidemic spread of cholera. Transcriptional profiling of V. cholerae from stool samples revealed a unique physiological and behavioural state characterized by high expression levels of genes required for nutrient acquisition and motility, and low expression levels of genes required for bacterial chemotaxis.

    Abstract

    Microarray expression profiling and the development of data-mining tools and new statistical instruments affords an unprecedented opportunity for the genome-scale study of bacterial pathogenicity. Expression profiles obtained from bacteria grown in media simulating host microenvironments yield a portrait of interacting metabolic pathways and multistage developmental programs and disclose regulatory networks. The analysis of closely related strains and species by microarray-based comparative genomics provides a measure of genetic variability within natural populations and identifies crucial differences between pathogen and commensal. In the near future, the combined use of bacterial and host microarrays to study the same infected tissue will reveal the host-pathogen dialogue in a gene-by-gene and site- and time-specific manner. This review discusses the use of microarray-based expression profiling to identify genes of pathogenic bacteria that are differentially regulated in response to host-specific signals. Additionally, the review describes the application of microarray methods to disclose differences in gene content between taxonomically related strains that vary with respect to pathogenic phenotype.

    Abstract

    The DNA microarray, a surface that contains an ordered arrangement of each identified open reading frame of a sequenced genome, is the engine of functional genomics. Its output, the expression profile, provides a genome wide snap-shot of the transcriptome. Refined by array-specific statistical instruments and data-mined by clustering algorithms and metabolic pathway databases, the expression profile discloses, at the transcriptional level, how the microbe adapts to new conditions of growth--the regulatory networks that govern the adaptive response and the metabolic and biosynthetic pathways that effect the new phenotype. Adaptation to host microenvironments underlies the capacity of infectious agents to persist in and damage host tissues. While monitoring the whole genome transcriptional response of bacterial pathogens within infected tissues has not been achieved, it is likely that the complex, tissue-specific response is but the sum of individual responses of the bacteria to specific physicochemical features that characterize the host milieu. These are amenable to experimentation in vitro and whole-genome expression studies of this kind have defined the transcriptional response to iron starvation, low oxygen, acid pH, quorum-sensing pheromones and reactive oxygen intermediates. These have disclosed new information about even well-studied processes and provide a portrait of the adapting bacterium as a 'system', rather than the product of a few genes or even a few regulons. Amongst the regulated genes that compose this adaptive system are transcription factors. Expression profiling experiments of transcription factor mutants delineate the corresponding regulatory cascade. The genetic basis for pathogenicity can also be studied by using microarray-based comparative genomics to characterize and quantify the extent of genetic variability within natural populations at the gene level of resolution. Also identified are differences between pathogen and commensal that point to possible virulence determinants or disclose evolutionary history. The host vigorously engages the pathogen expression studies using host genome microarrays and bacterially infected cell cultures show that the initial host reaction is dominated by the innate immune response. However, within the complex expression profile of the host cell are components mediated by pathogen-specific determinants. In the future, the combined use of bacterial and host microarrays to study the same infected tissue will reveal the dialogue between pathogen and host in a gene-by-gene and site- and time-specific manner. Translating this conversation will not be easy and will probably require a combination of powerful bioinformatic tools and traditional experimental approaches--and considerable effort and time.

    Abstract

    Macrophage activation determines the outcome of infection by Mycobacterium tuberculosis (Mtb). Interferon-gamma (IFN-gamma) activates macrophages by driving Janus tyrosine kinase (JAK)/signal transducer and activator of transcription-dependent induction of transcription and PKR-dependent suppression of translation. Microarray-based experiments reported here enlarge this picture. Exposure to IFN-gamma and/or Mtb led to altered expression of 25% of the monitored genome in macrophages. The number of genes suppressed by IFN-gamma exceeded the number of genes induced, and much of the suppression was transcriptional. Five times as many genes related to immunity and inflammation were induced than suppressed. Mtb mimicked or synergized with IFN-gamma more than antagonized its actions. Phagocytosis of nonviable Mtb or polystyrene beads affected many genes, but the transcriptional signature of macrophages infected with viable Mtb was distinct. Studies involving macrophages deficient in inducible nitric oxide synthase and/or phagocyte oxidase revealed that these two antimicrobial enzymes help orchestrate the profound transcriptional remodeling that underlies macrophage activation.

    Abstract

    Production of type IV bundle-forming pili by enteropathogenic Escherichia coli (EPEC) requires BfpB, an outer-membrane lipoprotein and member of the secretin protein superfamily. BfpB was found to compose a ring-shaped, high-molecular-weight outer-membrane complex that is stable in 4% sodium dodecyl sulfate at temperatures of View details for Web of Science ID 000170118600020

    Abstract

    In previously published work, we identified three Mycobacterium tuberculosis sigma (sigma) factor genes responding to heat shock (sigB, sigE and sigH). Two of them (sigB and sigE) also responded to SDS exposure. As these responses to stress suggested that the sigma factors encoded by these genes could be involved in pathogenicity, we are studying their role in physiology and virulence. In this work, we characterize a sigE mutant of M. tuberculosis H37Rv. The sigE mutant strain was more sensitive than the wild-type strain to heat shock, SDS and various oxidative stresses. It was also defective in the ability to grow inside both human and murine unactivated macrophages and was more sensitive than the wild-type strain to the killing activity of activated murine macrophages. Using microarray technology and quantitative reverse transcription-polymerase chain reaction (RT-PCR), we started to define the sigmaE regulon of M. tuberculosis and its involvement in the global regulation of the stress induced by SDS. We showed the requirement for a functional sigE gene for full expression of sigB and for its induction after SDS exposure but not after heat shock. We also identified several genes that are no longer induced when sigmaE is absent. These genes encode proteins belonging to different classes including transcriptional regulators, enzymes involved in fatty acid degradation and classical heat shock proteins.

    Abstract

    Unlike many pathogens that are overtly toxic to their hosts, the primary virulence determinant of Mycobacterium tuberculosis appears to be its ability to persist for years or decades within humans in a clinically latent state. Since early in the 20th century latency has been linked to hypoxic conditions within the host, but the response of M. tuberculosis to a hypoxic signal remains poorly characterized. The M. tuberculosis alpha-crystallin (acr) gene is powerfully and rapidly induced at reduced oxygen tensions, providing us with a means to identify regulators of the hypoxic response. Using a whole genome microarray, we identified >100 genes whose expression is rapidly altered by defined hypoxic conditions. Numerous genes involved in biosynthesis and aerobic metabolism are repressed, whereas a high proportion of the induced genes have no known function. Among the induced genes is an apparent operon that includes the putative two-component response regulator pair Rv3133c/Rv3132c. When we interrupted expression of this operon by targeted disruption of the upstream gene Rv3134c, the hypoxic regulation of acr was eliminated. These results suggest a possible role for Rv3132c/3133c/3134c in mycobacterial latency.

    Abstract

    The rugose colonial variant of Vibrio cholerae O1 El Tor produces an exopolysaccharide (EPS(ETr)) that enables the organism to form a biofilm and to resist oxidative stress and the bactericidal action of chlorine. Transposon mutagenesis of the rugose variant led to the identification of vpsR, which codes for a homologue of the NtrC subclass of response regulators. Targeted disruption of vpsR in the rugose colony genetic background yielded a nonreverting smooth-colony morphotype that produced no detectable EPS(ETr) and did not form an architecturally mature biofilm. Analysis of two genes, vpsA and vpsL, within the vps cluster of EPS(ETr) biosynthesis genes revealed that their expression is induced above basal levels in the rugose variant, compared to the smooth colonial variant, and requires vpsR. These results show that VpsR functions as a positive regulator of vpsA and vpsL and thus acts to positively regulate EPS(ETr) production and biofilm formation.


    Discussion

    We have devised a fully reversible experimental system to study equilibrium folding of an α-helical membrane protein in lipid bilayers. This has enabled the first determination of the thermodynamic stability of this class of protein in a bilayer. By extending classical chemical denaturation methods, the free energy of unfolding of LeuT has been measured from urea denaturation curves of the protein in a lipid bilayer. The linear dependence of the unfolding free energy on urea concentration allows extrapolation to zero denaturant and a free-energy value in the absence of urea. Membrane mechanical properties are known to modulate the folding, function, and stability of integral membrane proteins (3). The only previous example directly linking thermodynamic stability of membranes proteins to lipid membrane forces are for a bacterial outer membrane protein with β-barrel structure (51 ⇓ –53). The unfolding free energy of LeuT is also dependent on lipid bilayer composition, indicating α-helical structure stability is also coupled to bilayer properties. The unfolding free energy of LeuT increases with increasing PE or PG in a PC bilayer, indicating that both chain lateral pressure and negatively charged headgroups enhance the thermodynamic stability of LeuT, raising the magnitude of the unfolding free energy.

    Urea has been shown to be a suitable denaturant of α-helical membrane transporters, with reversible denaturant curves enabling free energies of unfolding to be determined for folded states in detergent micelles. This was demonstrated for members of the MFS, the galactoside transporters GalP and LacY from Escherichia coli (11, 12). Additionally, urea can denature these proteins in lipid bilayers. However, although these MFS proteins can be refolded back into the bilayer, it was not possible to establish reversible refolding to enable free-energy measurements. It was recently demonstrated that the insertion, stability, and functionality of LacY was heavily influenced by mechanical properties of the membrane (54) it is possible this effect could also carry over to reversibly unfolding in the membrane. MFS transporters have dynamic structures with 12-TM helices (55, 56) arranged in two domains, while the 12 helices of LeuT are in a knotted arrangement (44). Urea seems to denature MFS proteins in part via the substrate binding site at the domain interface. It is, however, unknown how much of the membrane embedded regions are affected by urea, and therefore the nature of the unfolding transition is unclear. In contrast, folding and stability of knotted membrane proteins has not been studied. The results here show that LeuT is more stable than the MFS proteins, and there is no loss of secondary structure upon addition of urea to LeuT in lipid bilayers (shown in SI Appendix, Fig. S5A). To enable urea to denature LeuT, a small amount of detergent OG is added to the bilayers, almost 100-fold lower than the CMC and 10-fold less than that used to presaturate liposomes during reconstitution. The addition of this small amount of OG detergent does not affect the structure or phase of the liposomes as seen by 31 P NMR and DLS, nor does it alter the protein structure. The OG nonetheless will partition into the bilayer, enabling urea to induce denaturation of LeuT it is possible that OG affects the lateral packing pressure of the surrounding bilayer, similarly to an earlier report (48). The successfully refolded state and agreement of the unfolding and refolding curves are independent of OG.

    The urea-denatured states of MFS and LeuT proteins are partly structured. The 8 M urea induces ∼30% reduction in α-helical structure for GalP and LacY MFS proteins, while LeuT loses ∼35% helicity upon 8 M urea denaturation in DDM micelles or ∼30% helicity in DOPC/DOPE (4:1 mol ratio) in the presence of 0.29 mM OG. The ability of urea to denature LeuT is dependent upon the lipid composition. Increasing lipid chain lateral pressure and headgroup charge increases the stability of LeuT to 8 M urea. A smaller reduction in helix is seen upon 8 M urea addition to DOPC liposomes with increasing amounts of DOPE or DOPG (SI Appendix, Table S2). LeuT suffers only a 10% reduction in helical structure in charged liposomes containing both DOPE and DOPG lipids upon the addition of 8 M urea. LeuT was functional in all liposomes studied, but lost transport activity when urea was added and regained >90% transport activity and original secondary structure content upon refolding in the liposomes (0.8 M urea, 0.04 nM OG), indicating refolding is highly efficient.

    The free energy for unfolding of LeuT in DDM, extrapolated to zero urea denaturant, ΔGU H2O , is found to be +3.1 ± 0.26 kcal·mol −1 . This is higher than the ΔGU H2O determined in DDM for GalP and LacY, which are both approximately +2.5 kcal⋅mol −1 . The free energy of unfolding of LeuT when reconstituted into DOPC/DOPE (4:1 mol ratio) ΔGU H2O is found to be +2.6 ± 0.1 kcal⋅mol −1 , which is lower than ΔGU H2O of LeuT in detergent micelles. This ΔGU H2O for LeuT increases to +2.9 ± 0.2 kcal·mol −1 in DOPC/DOPE (1:1 mol ratio) when the concentration of DOPE, and chain lateral pressure, is increased (Fig. 5). A further increase is observed if charge is introduced to DOPC bilayers, with ΔGU H2O being +3.8 ± 0.23 kcal⋅mol −1 in DOPC/DOPG bilayers (1:1 mol ratio).

    The ΔGU H2O free-energy values quoted are for unfolding in lipid bilayers with no urea present, and for the unfolding reaction between the folded state and the partly unfolded state. The only structural information for this latter unfolded state in urea is the secondary structure as determined from far-UV CD. The unfolded states for DOPC/DOPE contain 70% of the fully folded α-helical content. LeuT is more resistant to unfolding in urea when within DOPC/DOPG bilayers, retaining 80% of the folded α-helical content in 8 M urea. Despite the greater degree of structure present in the unfolded state in DOPC/DOPG bilayers, the free energy of unfolding of LeuT is greater in DOPC/DOPG than DOPC/DOPE. Thus, headgroup charge plays a significant role in the thermodynamic stability of LeuT. The introduction of DOPE into DOPC bilayers results in little change in the unfolded state helicity but an increase in the unfolding free energy, showing that chain lateral pressure also influences LeuT stability. This is consistent with previous predictions that increased chain pressure would stabilize a helical bundle.

    Fully denatured states of the α-helical class of membrane proteins are rarely encountered in vivo, nor can fully denatured states be used in equilibrium refolding studies. Partly denatured states in vitro have allowed folding equilibria to be established and the determination of the associated free energy (57). Not all helical membrane proteins can be denatured by urea or harsh detergents such as SDS, and for those that are, only a few can be refolded from these partly denatured states. Key interactions and structure are therefore presumably present in the partly denatured states that can be successfully refolded into lipids, while the lack of refolding is very likely to reflect aggregation (36, 58). SDS was the first denaturant to be used for thermodynamic measurements of helical membrane proteins (14). As for urea-denatured states, the residual structure in the SDS-denatured state of membrane proteins is not well understood. bR is the best characterized with respect to folding studies, with far-UV CD indicating a significant reduction in helicity (21, 23) and DEER suggesting a smaller reduction in helix structure and more or less complete loss of helix, helix tertiary interactions (59). Less direct information is available for SDS denatured states of other proteins that have been the subject of unfolding studies for example, GlpG in SDS exhibits no loss of helical structure and very little change in fluorescence emission band, which in any case is challenging to assign to definitive structural change (10, 60, 61).

    The use of urea denaturation in studies of membrane transporters gives a system with clear helical denaturation and ease of refolding by dilution directly into lipid bilayers. We find no evidence of urea (or OG at the concentrations well below the CMC here) affecting the lipid phase of liposomes by DLS or 31 P NMR. Moreover, linear free-energy relationships are observed for LeuT in bilayers with wide range of urea concentrations, as previously observed for MFS proteins in detergent (11, 12). The combined urea, OG (or mild detergent) approach to unfold the protein in the bilayer, as used here, could prove to be a starting point for future thermodynamic studies on other helical membrane proteins. However, since different proteins have different dependences on lipid bilayer properties, the exact lipids, detergents, and concentrations used are likely to need optimization. The major advantage of the mixed urea/OG approach over solvent-based approaches such as trifluoroethanol (TFE), is that the membrane is kept intact enabling refolding in bilayers. Potential issues with SDS and TFE include the ability of both to induce α-helical structure in polypeptide chains (even where there are no native helices) as well as perturbing and solubilizing the bilayer (62, 63).

    The strong influence of the solubilizing environment on the thermodynamic stability makes it difficult to compare absolute free energy of unfolding values for different membrane proteins. Nonetheless, it is possible to make certain evaluations. As well as valid comparisons between the unfolding energies for LeuT in different lipid bilayers, this work enables a comparison of the unfolding free energy of LeuT in detergent micelles and lipid bilayers. There is little difference in free energy of the folded LeuT state in DDM compared with that in DOPC/DOPE bilayers, with reference to an unfolded state with 60–65% native helical content. The stability of LeuT, however, is greater in DOPG/DOPE bilayers than DDM micelles. The surrounding solvent has a clear influence on membrane protein dynamics and stability and the precise nature of the underlying interactions in micelles compared with bilayers is unknown. Therefore, stabilizing detergents are inherently used during membrane protein purification, but finding a lipid bilayer that provides optimal stability requires considerable manipulation of lipid composition (64). It has also previously been shown that the TM glycophorin dimer can be more stable in detergent micelles than lipid bilayers (27).

    LeuT is native to the Archea Aquifex aeolicus where phosphatidylcholine is rare (65), and therefore the lipid may not be as effective in stabilizing the protein in the bilayer as the other compositions studied. Furthermore, it has to be taken into account that Archea membrane lipids are significantly more branched in the acyl region (66) than the synthetic phospholipids we have used, and such branching may play a role in determining stability of the protein in the bilayer. The thermodynamic comparisons here within PC/PE/PG bilayers show that charge and lateral pressure are important and can increase the thermodynamic stability of LeuT over that in micelles. In line with this charge role, the polar sugar headgroup of DDM may impart stability to LeuT, giving it similar stability to that in a neutral bilayer. This provides further evidence indicating that direct comparisons between detergent, bilayer, and other environments are not necessarily straightforward.

    Fig. 6 shows the ΔGU H2O values obtained here in bilayers compared with existing reports for membrane proteins in micelle and bicelles. There are only a small number of examples of thermodynamic stability measurements for membrane proteins (SI Appendix, Table S3). The values are obtained under different experimental conditions and using different approaches and assumptions. The unfolding free energies determined for LeuT in lipid bilayers (ΔGU H2O ranging from +2.5 to +3.8 kcal⋅mol −1 ) are of similar order of magnitude to that for LeuT in micelles as well as those previously reported for MFS proteins GalP and LacY in detergent micelles (11, 12). The values presented for the α-helical multi domain transporters unfolded by urea are smaller than stability measurements made for some single-domain helical membrane proteins in micelles or bicelles using SDS as denaturant. For cases where SDS has been shown to induce partial unfolding of helical structures [giving denatured states with ∼65% or 80% of native helix content for both bR and diacyl glycerol kinase (DGK)], values of +20.6 and +16 kcal⋅mol −1 have been reported for ΔGU H2O for bR (23) and trimeric DGK, respectively (14). The long linear extrapolation may overestimate the +20.6 kcal⋅mol −1 bR unfolding free-energy value, with steric trapping measurements reporting +11 kcal⋅mol −1 (67). The unfolding states and folding reactions of bR are complex, and there are various stages of binding of the retinal cofactor. SDS denaturation at equilibrium and steric trapping probably measure different folding reactions, with a dissimilar unfolded state sterically trapped by the streptavidin binding compared with that obtained via SDS denaturation (including with regard to retinal binding). Retinal binding could also account for an increased stability over other proteins the free energy for noncovalent retinal binding (and associated protein folding) has been determined as −7 kcal⋅mol −1 (68), and further stabilization is thought to occur during covalent binding and final folding, for which an enthalpy change for of −95 kcal⋅mol −1 has been reported in membranes (69). There are also reports of unfolding free energies in detergent micelles using SDS as denaturant for DsbB and GlpG, with ΔGU H2O values of +4.4 and +8.2 kcal⋅mol −1 (60, 70). In both of these latter cases, there is no reduction in helical structure in the SDS denatured state and little information on tertiary structure hence the nature of the unfolding/folding reaction is less certain. Steric trapping provides a lower unfolding free energy of +5.8 kcal⋅mol −1 or +4.7 kJ⋅mol −1 for GlpG in detergent micelles (depending upon the site of Cys mutations for attachment of the double biotin labels) (71), while a value of +3.9 kcal⋅mol −1 has been inferred at zero force applied from innovative mechanical unfolding studies (72).

    Values of calculated ΔGU H2O values for membrane proteins extrapolated from unfolding curves the first notable examples have been annotated on the figure all values are summarized in SI Appendix, Table S1. Circles indicate α-helix proteins, whereas squares indicate β-barrels. Additionally, color indicates the membrane mimetic used either detergent (white), bicelles (green), or lipid bilayer (blue). Vertical strikethrough indicates that steric trapping was used to generate the ΔGU H2O diagonal strikethrough indicates mechanical unfolding was used. For α-helical proteins: DGK is a trimer but the value obtained was for the monomer (14), KcsA is a tetramer and the value obtained refers to tetramer-to-monomer transition (62), bR structure is stabilized by a cofactor (23), DsbB (70) and GlpG (60) area single-domain α-helical protein, GalP (11), LacY (12), and LeuT are multidomain α-helical proteins. For β-barrels: OmpA was the first ΔGU H2O generated for a protein in a bilayer (52, 53), followed by PagP* measured with an N-terminal his tag (74), followed with the release of OmpLA (74), OmpW (74), and PagP (74). ΔGU H2O of GlpG have also been calculated using novel methods such as steric trapping (with the ΔGU H2O for 95/172N-BtnPyr2 variant shown) (71) and mechanical unfolding (72).

    There are no other thermodynamic unfolding free energy measurements for helical membrane proteins in lipid bilayers. Values do exist for β-barrel membrane proteins (51 ⇓ –53). β-Structured proteins are generally less hydrophobic and can often be fully denatured in urea, and some have been reversibly refolded into bilayers giving the associated free energy of the unfolding reaction. β-Barrel proteins also have thermodynamic stabilities that are modulated by the bilayer properties (53). The native membrane of most of the barrel proteins studied is the outer membrane of E. coli, which contains lipopolysaccharide primarily in a thinner outer bilayer leaflet and is enriched in PE in the inner leaflet (73). Studies of barrels have focused on the nonnative bilayer lipid, POPC, under varying conditions. A ΔGU H2O of +3.4 kcal⋅mol −1 was found for the β-barrel protein OmpA, and the thermodynamic stability was also shown to increase with increasing PE content (53). Our results on LeuT show that an increase in chain lateral pressure, as caused by the introduction to PE to PC bilayer, increase the thermodynamic stability of both β-barrel and α-helical TM structures. SI Appendix, Table S3 and review (74) give other values obtained for β-barrel proteins in bilayers under a variety of conditions.

    Despite significant advances, helical membrane proteins remain severely underrepresented in protein folding studies. Experiments in bilayers are paramount to understand membrane protein folding. The advances reported here finally enable comparisons of thermodynamic stability in a bilayer. This has important ramifications. In addition to providing insight into the coupling of protein thermodynamic stability to bilayer mechanics and charge, it will also enable comparison of the effect of mutations on unfolding free energies. In turn, combined with kinetic measurements, this has the potential to give information on folding intermediates and transition states in bilayers through ϕ-value analyses (23). The LeuT fold contains a complex trefoil knot involving 55% of the total amino acids 278 aa out of a total 511 aa in the protein from residue 15–293 encompassing the first seven helices (shown in SI Appendix, Fig. S1A, i). LeuT unfolds reversibly losing up to 40% of the secondary structure under both detergent and bilayer conditions. It is unclear how much of the knot is perturbed by urea. Further work is required, for example using mutagenesis, in conjunction with the approach described here to identify how residues in different regions of the knot influence the free energy of LeuT.

    Synthetic bilayer studies also provide information that cannot be gained in cellular membranes and are more informative comparison than detergent systems. Although this work moves helical membrane protein folding toward thermodynamic and mechanism in bilayers, the challenges must not be underestimated. The difficulties are illustrated in the time taken to reach this point where measurements can now begin in lipid bilayers. Folding studies commenced on helical membrane proteins in the late 1980s (20), followed a decade later by the establishment of chemical denaturation to probe thermodynamics in detergent (14, 75) and another decade later by the first ϕ-value analyses to investigate transition states in bicelles (23). However, another 9 y on, we report the ability to determine thermodynamic stability in lipid bilayers. Rather than focusing on a small model protein and in order that the results are more informative, we have deliberately ensured the system works for the knotted membrane protein LeuT, a paralogue of human neurotransmitter transporters.


    Materials And Methods

    Malaria parasites

    P. falciparum parasites (3D7) were maintained in continuous in vitro culture in human RBCs suspended in Hepes-buffered RPMI 1640 supplemented with 0.5% AlbumaxII using standard procedures (Cranmer et al., 1997). Cultures were kept synchronous, and the knob-positive phenotype was maintained by gelatin floatation (Waterkeyn et al., 2001). Clonal parasite lines were derived by the method of limiting dilution.

    Plasmid constructs

    To disrupt the sbp1 gene in 3D7 parasites, 5′ and 3′ sequences of ∼1 kb flanking the sbp1 gene were cloned into the P. falciparum transfection plasmid pHHT-TK (gift from A. Cowman and B. Crabb, The Walter and Eliza Hall Institute, Melbourne, Australia Duraisingh et al., 2002) to derive pHTKΔsbp1 (Fig. 2 A). Specifically, the 5′ segment of sbp1 (including 458 bp of the 5′ untranslated sequence) was amplified from genomic DNA from 3D7 parasites using forward and reverse primers 5′TC CCCGCGG cgatacaaccctccttttatg3′ (SacII site underlined) and 5′GG ACTAGT gacatagattcggctgga3′ (SpeI site underlined), respectively, and was subcloned into the SacII and SpeI sites of pHHT-TK upstream of the hdhfr resistance cassette. The 3′ segment of sbp1 (including 437 bp of the 3′ untranslated sequence) was amplified using the forward and reverse primers 5′CG GAATTC gcagattttgcaaaacaagc3′ (EcoRI site underlined) and 5′CATG CCATGG catatacataaacgatcaaaag3′ (NcoI site underlined), respectively, and was introduced into the EcoRI and NcoI sites downstream of the hdhfr cassette. Plasmid DNA was amplified in Escherichia coli and purified using MegaPrep (QIAGEN).

    For complementation, the full-length sbp1 gene (excluding the stop codon) was PCR amplified from 3D7 cDNA using the forward and reverse primers 5′CACCTATATACAatgtgtagcgcagctcgagca3′ and ggtttctctagcaactgtttttg, respectively, and was cloned using topoisomerase into the multisite Gateway entry vector pENTR/D-TOPO (Invitrogen). This was recombined together with pDONR P4-P1R vector containing the P. falciparum Hsp86 promoter and pDONR P2R-P3 vector containing the EYFP reporter gene into a destination vector, pHrB1-1/2, that had been previously modified for use in P. falciparum (van Dooren et al., 2005) to produce the expression plasmid pHrB1-1/2-sbp1.

    Parasite transfection

    Ring-stage parasites were transfected by electroporation with 150 μg of purified supercoiled plasmid DNA (pHTkΔsbp1) diluted in cytomix according to standard procedures (Wu et al., 1996) but using modified electroporation conditions to enhance DNA delivery (Fidock and Wellems, 1997). Transfected parasites were cultured in the presence of 2.5 nM of the antifolate drug WR99210 (Fidock and Wellems, 1997) for ∼30 d until viable parasites were observed in Giemsa-stained smears. 4 μM ganciclovir (Roche Diagnostics) was then added to select for parasites having only double crossover homologous recombination (Duraisingh et al., 2002). For complementation, positive selection for parasites transformed with pHrB1-1/2-sbp1 was performed using 8 μM blasticidin S hydrochloride (Calbiochem) as previously described (Mamoun et al., 1999).

    DNA extraction and Southern blotting

    Genomic DNA was extracted from parasite culture using the Nucleon BACC2 kit (GE Healthcare), digested with ClaI and EcoRI, separated on 1% agarose gels, and transferred to nylon membranes. Southern blot hybridization was performed using standard procedures.

    Western blotting

    Cultured IRBCs were harvested on Percoll and solubilized in 2× reducing SDS sample buffer containing protease inhibitor cocktail (Roche Diagnostics). These total parasite extracts were separated on 10% SDS-PAGE gels and transferred to polyvinylidene difluoride (PVDF) membranes. Membranes were probed with rabbit polyclonal anti-HSP70 (1:10,000), mouse polyclonal anti-SBP1 (1:400), or mouse monoclonal antiglycophorin C (1:500 Sigma-Aldrich) antibodies. Detection by enhanced chemiluminescence (Lumi-light Western blotting substrate Roche Diagnostics) was performed after secondary detection with either sheep anti–rabbit or sheep anti–mouse Ig-HRP conjugate (1:2,000 Silenus).

    Analysis of PfEMP1 expression on the surface of IRBCs by trypsin cleavage assay

    The trypsin cleavage assay was performed as previously described (Waterkeyn et al., 2000) to visualize PfEMP1 expressed on the IRBC surface. In brief, mature IRBCs were enriched on Percoll as previously described (Dluzewski et al., 1984) and were incubated with 100 μg/ml TPCK-treated trypsin (Sigma-Aldrich) in the presence or absence of 1 mg/ml soybean trypsin inhibitor (STI Sigma-Aldrich) for 15 min at 37°C. Reactions were stopped by the addition of STI to a final concentration of 1 mg/ml followed by a further incubation of 15 min at room temperature. Membrane proteins (including PfEMP1) were extracted using Triton X-100 and SDS solubilization as described previously (Van Schravendijk et al., 1993) and diluted in reducing Laemmli sample buffer. Samples were separated on 6% SDS-PAGE gels and transferred for 4 h at 4°C onto PVDF membranes. The cytoplasmic tail of PfEMP1 (VARC) was detected using the mouse monoclonal antibody 1B/98-6H1-1 (1:100 gift from The Walter and Eliza Hall Institute).

    Fluorescence and confocal microscopy

    For indirect immunofluorescence, cultured RBCs were fixed in suspension with 4% PFA containing 0.0075% glutaraldehyde in PBS, permeabilized with 0.1% Triton X-100, and blocked with 3% BSA in PBS as previously described (Tonkin et al., 2004). Cells were then incubated for 1 h with either mouse polyclonal anti-SBP1 (1:500), rabbit polyclonal anti-KAHRP (1:500), rabbit polyclonal anti-Pf332 (1:200), rabbit polyclonal anti–REX-1 (1:2,000 gift from D. Gardiner, Queensland Institute of Medical Research, Brisbane, Australia), mouse polyclonal anti–MAHRP-1 (1:200 gift from C. Spycher and H.-P. Beck, Swiss Tropical Institute, Basel, Switzerland), or rabbit polyclonal anti-GFP (1:1.000 Invitrogen). For PfEMP1 localization using rabbit polyclonal anti-VARC (1:100), detection was performed using thin culture smears that had been air dried and fixed with cold acetone/methanol (9:1) because this antibody showed poor reactivity when used on RBCs that had been fixed with PFA/glutaraldehyde in suspension using the method of Tonkin et al. (2004). Primary antibodies were then detected using either anti–mouse or anti–rabbit IgG conjugated to AlexaFluor488 or -568 (Invitrogen) and visualized using a laser-scanning confocal microscope (model TCS NT Leica) equipped with a krypton/argon laser (488/568 nm). The confocal scan head was mounted on an inverted microscope (model DM RBE Leica) equipped with a 100× NA 1.4 oil plan-Apo objective. All images of individual RBCs shown in figures are representative of numerous similar RBCs in multiple fields of view. Green fluorescence of EYFP-expressing transformants was observed using live unfixed RBCs directly from culture under 513-nm light using a fluorescence microscope (BX51 Olympus).

    Morphometric analysis of knobs and Maurer's clefts by electron microscopy

    RBCs from synchronous cultures containing predominantly mature stage parasites (late trophozoites/young schizonts) were fixed by the dilution of packed RBCs into isotonic PBS containing 2.5% (vol/vol) electron microscopy grade glutaraldehyde (Sigma-Aldrich). After routine preparative procedures (Bannister et al., 2003), ultrathin sections were prepared for transmission electron microscopy and pelleted for SEM. Random images of IRBCs were captured digitally at a magnification of 20,000× in an electron microscope (H7600 Hitachi) and analyzed using Scion Image software (v4.0.2). Electron-dense knobs and Maurer's clefts were counted manually for each IRBC. A total of 32 IRBCs were examined for each of the parasite lines 3D7 and 1G8. Parameters measured were (1) the perimeter of each IRBC, (2) the total sectional area of each IRBC, and (3) the sectional area of the parasite (if more than one parasitewas present, their areas were added together). From the second and third parameters, the area of IRBC external to the parasite was obtained by subtraction. Knobs and Maurer's clefts were counted manually to determine their frequencies.

    IRBC adhesion assays

    The adhesive properties of IRBCs were quantified using both static and flow-based assays. Parasite cultures were tested when the majority of parasites were pigmented trophozoites as assessed by Giemsa-stained smears. Cultured RBCs were resuspended in adhesion buffer (Hepes-buffered RPMI 1640 supplemented with 1% BSA and pH adjusted to 7.0) to a concentration of ∼3 × 10 8 RBCs/ml for static adhesion assays or 1.5 × 10 8 RBCs/ml for flow-based assays. For all adhesion assays, the parasitemia averaged ∼4.4% trophozoites (range of 2.2–7.8%). Static assays were performed in 36-mm petri dishes as previously described (Beeson et al., 1998) except that purified recombinant CD36 (R&D Systems) was immobilized as the target receptor (100 μg/ml). Adhesion to CD36 under flow conditions that mimic those in postcapillary venules was visualized and quantified in vitro by direct microscopic observation on a microscope (IMT-2 Olympus) with a 40× water immersion objective (Olympus) using flat, rectangular glass microcapillary tubes (Microslides VitroCom, Inc.) connected to a flow-control system as previously described (Cooke et al., 2002a,b).

    Online supplemental material

    Fig. S1 shows the results from immunoprecipitation and FRET experiments to demonstrate that there is no direct molecular interaction between SBP1 and PfEMP1 in IRBCs infected with 3D7 parasites. Supplemental text provides details of these FRET and immunoprecipitation experiments.


    How is Glycophorin A and straphylococcal related to Escherichia coli and what does readily purified mean in this context? - Biology

    Oligomerization of viral envelope proteins is essential to control virus assembly and fusion. The transmembrane domains (TMDs) of hepatitis C virus envelope glycoproteins E1 and E2 have been shown to play multiple functions during the biogenesis of E1E2 heterodimer. This makes them very unique among known transmembrane sequences. In this report, we used alanine scanning insertion mutagenesis in the TMDs of E1 and E2 to examine their role in the assembly of E1E2 heterodimer. Alanine insertion within the center of the TMDs of E1 or E2 or in the N-terminal part of the TMD of E1 dramatically reduced heterodimerization, demonstrating the essential role played by these domains in the assembly of hepatitis C virus envelope glycoproteins. To better understand the alanine scanning data obtained for the TMD of E1 which contains GXXXG motifs, we analyzed by circular dichroism and nuclear magnetic resonance the three-dimensional structure of the E1-(350–370) peptide encompassing the N-terminal sequence of the TMD of E1 involved in heterodimerization. Alanine scanning results and the three-dimensional molecular model we obtained provide the first framework for a molecular level understanding of the mechanism of hepatitis C virus envelope glycoprotein heterodimerization.

    Published, JBC Papers in Press, May 11, 2000, DOI 10.1074/jbc.M003003200

    This work was supported by the CNRS, Institut Pasteur de Lille, European Regional Development Fund (ERDF), a PRFMMIP grant from the French Ministry of Research, European Union Grant QLK2-1999-00356, and Association pour la Recherche sur le Cancer (ARC) Grant 9736. Support was also provided by a fellowship from ARC and the Agence Nationale de la Recherche sur le Sida (ANRS) (to A. O. D. B.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

    The atomic coordinates for the NMR structure of the E1-(350–370) fragment and the NMR restraints are available in the Research Collaboratory for Structural Bioinformatics Protein Data Bank under accession number (RCSB010735). The proton chemical shifts of all residues have been deposited in the BioMagResBank (BMRB) under the accession number 4699.


    Immunoconjugates of the Invention

    A further aspect of the invention relates to an immunoconjugate comprising the VHH according to the invention conjugated to at least one chemical compound.

    The immunoconjugate of the invention results from the chemical coupling of the VHH to the chemical compound, either directly or optionally via a linker, to form a conjugate. Mutation of the VHH to introduce a supplementary cysteine in the sequence, preferably but not exclusively at the C-terminus is envisioned as an easy way to couple chemical compounds to the VHH.

    Such conjugate is therefore obtained by coupling (either by covalent or non-covalent coupling) of the VHH with the chemical compound, optionally via a linker.

    The covalent linkage between the VHH and the chemical compound is typically obtained via the use of a coupling or cross-linking agent, and optionally a linker for covalent linkage of both molecules while maintaining their functionality, or allowing cleavage. A variety of coupling or cross-linking agents can be used for making the immunoconjugates of the invention. Examples of cross-linking agents include carbodiimide, N-succinimidyl-S-acetyl-thioacetate (SATA), 5,5′-dithiobis(2-nitrobenzoic acid) (DTNB), o-phenylenedimaleimide (oPDM), N-succinimidyl-3-(2-pyridyldithio)propionate (SPDP), and sulfosuccinimidyl 4-(N-maleimidomethyl)cyclohaxane-1-carboxylate (sulfo-SMCC) (see e.g. Karpovsky et al., 1984 J. Exp. Med. 160: 1686 Liu, M A et al., 1985 Proc. Natl. Acad. Sci. USA 82:8648). Other methods include those described in Paulus, 1985 Behring Ins. Mitt. No. 78,1 18-132 Brennan et al., 1985 Science 229:81-83), and Glennie et al., 1987 J. Immunol. 139: 2367-2375). Examples of linker types include, but are not limited to, hydrazones, thioethers, esters, disulfides and peptide-containing linkers. A linker can be chosen that is, for example, susceptible to cleavage by low pH within the lysosomal compartment or susceptible to cleavage by proteases.

    Typically, the chemical compound is a therapeutic chemical compound.

    As used herein, the term “therapeutic chemical compound” refers to any chemical compound that can be administered to a patient to produce a beneficial therapeutic or diagnostic effect though binding to and/or altering the function of a biological target molecule in the patient. The target molecule can be an endogenous target molecule encoded by the patient's genome (e.g., an enzyme, receptor, growth factor, cytokine encoded by the patient's genome) or an exogenous target molecule encoded by the genome of a pathogen (e.g., an enzyme encoded by the genome of a virus, bacterium, fungus, nematode or other pathogen).

    Typically, therapeutic chemical compound include but are not limited to immunosuppressive agents (e. g., cyclosporin A, rapamycin, FK506, prednisone), antiviral agents (acyclovir, ganciclovir, indinavir), antibiotics (penicillin, mynocyclin, tetracycline), anti-inflammatory agents (aspirin, ibuprofen, prednisone), cytotoxins or cytotoxic agents (e. g., paclitaxel, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin C, etoposide, tenoposide, vincristine, vinblastine, colchicine, doxorubicin, daunorubicin, dihydroxy anthracindione, mitoxantrone, mithramycin, actinomycin D, 1-dihydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, puromycin, and analogs or homologs of any of the foregoing agents. Suitable drugs also include antimetabolites (e.g., methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-fluorouracil decarbazine), alkylating agents (e. g., mechlorethamine, thioepachlorambucil, CC-1065, melphalan, carmustine (BSNU), lomustine (CCNU), cyclophosphamide, busulfan, dibromomannitol, streptozotocin, mitomycin C, and cis-dichlorodiamine platinum (II) (DDP) cisplatin), anthracyclines (e. g., daunorubicin (formerly daunomycin) and doxorubicin), antibiotics (e. g., dactinomycin (formerly actinomycin), bleomycin, mithramycin, and anthramycin (AMC)), radionuclides (e. g., iodine-125,-126) yttrium (e. g., yttrium-90,-91) and praseodymium (e.g., praseodymium-144,-145), and protease inhibitors (e.g., inhibitors of matrix metalloproteinases).

    In one embodiment, therapeutic chemical compound include but are not limited to analgesic agents, including narcotics (e.g., codeine, nalmefene, naloxone, fentanyl, meperidine, morphine, tramadol, propoxyphene, oxycodone, methadone, nalbuphine), nonsteroidal anti-inflammatory agents (e. g., indomethacin, ketorolac, arthrotec, ibuprofen, naproxen, salicylate, celecoxib, rofecoxib), acetaminophen, capsaicin, and ziconotide.

    In a particular embodiment, the therapeutic chemical compound is a therapeutic nucleic acid such as antisense nucleic acids and RNAi.


    RESULTS

    Expression of AE1 Mutants in HEK-293 Cells

    A panel of single and double tunnel mutants at equivalent positions (Arg 283 and Glu 85 Fig. 1 ) to those (Arg 298 and Glu 91 ) conserved in human NBCe1 ( Fig. 1 ) were prepared in human AE1 and expressed in HEK-293 cells. An HA tag was engineered into the third extracellular loop to facilitate detection of the protein by immunoblotting and by immunofluorescence. AE1 expressed in HEK-293 cells migrates on SDS-polyacrylamide gels as a single predominant band with a molecular mass of 95 kDa with small amounts of upper bands ( Fig. 2 , lane 1). Previous enzymatic deglycosylation experiments (41) revealed that the upper bands contained complex oligosaccharide and the major lower band contained high mannose oligosaccharide. Mutation of the single N-glycosylation site in AE1 (N642D) produced a single band that ran slightly faster than the lower high mannose form, confirming the presence of N-linked oligosaccharide on AE1 expressed in HEK cells ( Fig. 2 , lane 9). Although AE1 expressed in HEK-293 cells contains mainly high mannose oligosaccharide, about one-third of this form as well as the complex form is present at the cell surface with the remaining two-thirds localized in the ER (11).

    Immunoblot analysis of total expression of HA-tagged human AE1 tunnel mutants in transfected HEK-293 cells. Cells were grown for 48 h, harvested, and lysed in PBS with 1% C12E8. Proteins in whole cell detergent extracts were resolved by SDS gel electrophoresis, transferred to nitrocellulose, and probed with mouse anti-HA antibody to detect tagged AE1. A, immunoblot showing the total expression of AE1 and the mutants. Lanes 1� correspond to AE1, E85A, E85R, R283A, R283E, R383S, E85R/R283E, AE1-His, and N642D-His (left panel) and to AE1, kAE1, mdAE1, E681Q, and P868L (right panel). The filled circles represent AE1 with complex oligosaccharide, and the open circles represent AE1 with high mannose oligosaccharide. The migration positions of molecular mass markers are shown in kDa. B, quantification of total expression levels of AE1 mutants normalized to GAPDH expression from three independent transfection experiments. Error bars represent S.D.

    Immunoblot analysis of whole cell detergent extracts of transfected HEK-293 cells showed that the expression levels of all of the tunnel mutants were comparable with wild-type AE1 ( Fig. 2 , lanes 2𠄷). We also expressed kAE1 that has an altered cytosolic domain (residues 66�) mdAE1 (residues 361�) that lacks the entire cytosolic domain and two additional mutants, E681Q that has a low anion transport activity (42, 43) and P868L (Band 3 high transport) that has a high anion transport activity in red cells (44, 45). The expression levels of kAE1 ( Fig. 2 , lane 11) and AE1 with functional mutations in the membrane domain (E681Q and P868L) were similar to AE1 ( Fig. 2 , lanes 13 and 14). Thus, the level of intrinsic transport activity of AE1 does not affect the expression level of the protein to any great extent. Although direct comparison of expression levels of mdAE1 with AE1 cannot be made due to the different size and transfer efficiency during immunoblotting, the mdAE1 was also readily detected using the anti-HA antibody ( Fig. 2 , lane 12). The combined results for several (n = 3) independent transfections normalized to GAPDH are summarized in Fig. 2 B and Table 1 . The normal expression levels for all of the tunnel mutants show that the mutations introduced into the cytosolic domain did not cause AE1 to severely misfold and be targeted for degradation when expressed in HEK cells.

    TABLE 1

    Functional expression of HA-tagged AE1 mutants in HEK-293 cells

    The HA tag was inserted into the third extracellular loop of AE1 to facilitate detection on immunoblots and at the cell surface of transfected intact HEK-293 cells. ND, not determined pRTA, proximal renal tubular acidosis.

    ConstructRelative expression levelsCell surface expression a (+/−)Cell surface expression bRelative transport activity cComments
    % %%
    AE1(100)+42 ± 5(100)HA-tagged control
    E85A97 ± 12+58 ± 6122 ± 17Arg 283 -interacting residue
    E85R111 ± 34+50 ± 3114 ± 12Charge reversal
    R283A113 ± 24+31 ± 2114 ± 1Glu 85 -interacting residue
    R283E130 ± 37+49 ± 1141 ± 15Charge reversal
    R283S129 ± 13+42 ± 3120 ± 16pRTA equivalent mutant
    E85R/R283E109 ± 16+57 ± 1131 ± 12Double reversal mutant
    kAE1163 ± 20+NDNDTruncated cytosolic domain
    mdAE188 ± 13+47 ± 2118 ± 14No cytosolic domain
    E681Q84 ± 28+40 ± 418 ± 3Low transport mutant
    P868L114 ± 18+38 ± 1111 ± 11High transport mutant
    AE1SAONDNDNDInactive, retained in ER
    N642D-His97 ± 6+NDNDN-Glycosylation mutant
    AE1 (untagged)ND+40 ± 1123 ± 13No HA tag

    a Determined by immunofluorescence detection of HA tag in intact cells.

    b Determined by cell surface biotinylation.

    c Corrected for background activity of the vector control and normalized for the amount of AE1 at the cell surface.

    As an aside, kAE1 and more so mdAE1 displayed a higher proportion of complex oligosaccharide compared with full-length AE1 (� and 75% for kAE1 and mdAE1, respectively, versus 18% for AE1) when expressed in HEK cells ( Fig. 2 , lane 10 versus lanes 11 and 12). How changes to the cytosolic domain affect oligosaccharide processing on the opposite side of the membrane requires further investigation. Previous studies have indicated that the position of the oligosaccharide chain on different extracellular loops of AE1 affects its processing (41).

    Immunolocalization of AE1 Mutants

    We next examined the cellular localization of the tunnel mutants using immunofluorescence staining and confocal microscopy to determine whether the mutation affected trafficking of AE1 to the cell surface ( Fig. 3 ). AE1 HA-tagged in extracellular loop 3 was localized at the cell surface in intact cells (green). Cells were then permeabilized, and the total population of AE1 was detected (red). AE1 showed a predominant cell surface staining (yellow corresponds to overlap of green and red) in transfected HEK-293 cells as observed previously (11) as did all the tunnel mutants and mdAE1. AE1 and the tunnel mutants also showed intracellular staining (red) that co-localized with calnexin, an ER marker (not shown). Similarly, kAE1 and the E681Q and P868L mutants also showed cell surface expression, whereas the AE1SAO deletion mutant was entirely localized intracellularly in the ER as reported previously (46). Thus, introducing the tunnel mutations into the cytosolic domain of AE1 does not prevent their cell surface expression. Indeed, the mdAE1 was also localized at the cell surface, showing that the cytosolic domain is not required for the trafficking of AE1 to the plasma membrane.

    Localization of human AE1 mutants in transfected HEK-293 cells using immunofluorescence and confocal microscopy. All constructs had an HA epitope inserted in the third extracellular loop to allow detection of cell surface expression in intact cells. Fixed and non-permeabilized cells were incubated with mouse anti-HA antibody followed by Alexa Fluor 488-conjugated anti-mouse antibody (green) to detect cell surface AE1. Washed cells were then permeabilized with detergent and incubated with mouse anti-HA antibody followed by anti-mouse Cy3 (red) to detect total AE1 expression. Yellow is the overlap of the green and red and represents AE1 found at the cell surface. Calnexin, a marker for the ER, was detected using a rabbit anti-calnexin antibody followed by anti-rabbit IgG-Cy5 (not shown). Note that all mutants except AE1SAO, which is found exclusively in the ER, were present at the cell surface (yellow) as well as in the ER (red).

    Bicarbonate Transport Activity of AE1 Mutants

    The anion transport activities of the tunnel mutants were tested in transfected HEK-293 cells loaded with 2′,7′-bis(2-carboxyethyl)-5-(and -6-)carboxyfluorescein, a pH-sensitive fluorescent dye ( Fig. 4 ). Cells equilibrated in bicarbonate- and chloride-containing medium were shifted to chloride-free medium, which induced AE1-mediated chloride exit from the cells in exchange for bicarbonate, leading to alkalinization of the cytosol. Readdition of chloride-containing medium led to bicarbonate efflux in exchange for chloride and acidification of the cytosol (32, 47). HEK-293 cells transfected with empty vector (pcDNA3) had little detectable chloride/bicarbonate exchange activity, whereas wild-type (WT) AE1 had robust activity ( Fig. 4 A). The R283S mutant had a transport activity similar to wild-type AE1. The E681Q mutant was impaired in transport but had residual activity above the vector control, showing that it was not completely inactive as determined by this assay in HEK cells.

    Anion transport activity of human HA-tagged AE1 mutants in transfected HEK-293 cells. A, transport assay traces showing activity of AE1, R263S, E681Q, and vector (pcDNA3) control. B, bar graph showing anion transport activity of various HA-tagged AE1 mutants relative to AE1-HA, which is set at 100%. Results are the average of three or more assays performed on separate batches of transfected cells. Transport activity was corrected for the background activity found in HEK-293 cells and normalized relative to cell surface expression determined by biotinylation assays. Only the E681Q mutant showed a statistically significant (p < 0.01) decrease in transport activity relative to AE1. Error bars represent S.D.

    The results of three independent transport assays of the panel of mutants corrected for background transport activity of the vector control and normalized to cell surface expression levels as determined by biotinylation assays are shown in Fig. 4 B and are summarized in Table 1 . All of the tunnel mutants showed cell surface expression levels and whole cell anion transport activities comparable with wild-type AE1 ( Table 1 ). AE1 R283S, containing the mutation at the homologous position that causes proximal renal tubular acidosis mutation in NBCe1, had transport activity similar to AE1. Thus, this arginine residue does not play an essential role in the anion translocation process by AE1. The E85A and E85R mutants also showed normal transport activity, suggesting that this residue is also not essential for the transport process in AE1. The double 𠇌harge reversal” mutant (E85R/R283E) showed normal transport activity too. Expression of the membrane domain of AE1 in HEK-293 cells resulted in a high level of transport activity, confirming that the cytosolic domain is not required for transport activity (25). AE1 with an external HA tag was used as a control as the tunnel mutants also contained the HA tag and were derived from this construct. The HA-tagged AE1 had similar transport activity compared with untagged AE1 in two different vectors, pcDNA3 (AE1WT) (11) and pJRC9 (JRAE1) (47) ( Table 1 ). Therefore, the introduction of the extracellular HA tag into extracellular loop 3 does not impair the functional expression of AE1.

    The transport assay data show that none of the tunnel mutants were impaired in transport activity to the level of the E681Q mutant ( Table 1 ). Glu 681 was shown previously to be required for chloride/bicarbonate exchange (42, 43, 48, 49) and was used as a transport-defective control. The E681Q mutant had a very low transport activity (18% versus AE1-HA) in transfected cells but slightly above the empty vector control, indicating some residual transport activity. We also tested P868L, which is reported to have a 2𠄳-fold enhanced transport activity in red blood cells (45). This mutant, however, had a normal level of transport activity when assayed in transfected HEK-293 cells. This suggests that the transport activity of this mutant is dependent upon its cellular context. HEK-293 cells, for example, do not express red cell proteins, including Glycophorin A, that are known to influence the transport activity of AE1 (50�). The transport assays clearly show that mutation of residue Arg 283 or Glu 85 within the cytosolic domain does not impair the anion transport activity of AE1 when expressed in HEK-293 cells.

    Crystal Structure of cd�

    In 2000, a crystal structure of cdAE1 obtained to 2.6-Å resolution was reported by Low and co-workers (24). It revealed the dimeric nature of cdAE1 and many of its important structural features. The crystals were produced from recombinant protein at low pH (4.8) using ammonium sulfate as the precipitant (53, 54). The cytosolic domain of AE1 undergoes dramatic structural changes going from a compact structure at low pH to a more open and asymmetric structure at neutral and alkaline pH (26, 27, 53, 55), leaving open the question of whether the structure obtained under acidic conditions differs from the structure at neutral pH. To obtain a crystal structure of cdAE1 under more physiological conditions, we removed the intrinsically disordered acidic N-terminal region (residues 1�) and the C-terminal linker region (residues 357�) not visible in the original crystal structure. We were able to produce a new crystal form of cd� (residues 55�) using PEG as precipitant at pH 6.5 that diffracted to 2.1 Å ( Fig. 5 and supplemental Table 1). The space group was P212121 with two monomers in the asymmetric unit (a, 69.9 Å b, 80.7 Å c, 104.3 Å with α, β, γ = 90°).

    Crystal structure of cd� at pH 6.5. A, ribbon diagram of cd� showing the dimeric structure with chain A in orange and chain P in teal. B, comparison of the pH 6.5 structure determined here (colored orange and teal) with the previous pH 4.8 crystal structure (Protein Data Bank code 1HYN colored brown and green). C, enlarged view of the tunnel region with important residues labeled. D, a 2FoFc electron density map showing the hydrogen-bonded network of Arg 283 and Glu 85 . aa, amino acids.

    Like cdAE1, cd� is a dimer consisting of an N-terminal interaction domain (residues 55�) and C-terminal dimerization arms (residues 314�) involved in domain swapping. The results indicate that the acidic N-terminal extension has little effect on the core structure of cdAE1, consistent with the first 54 residues operating as its own independent intrinsically disordered region involved in protein interactions with cytosolic proteins such as hemoglobin (56). There are subtle differences between the two monomers in the dimer that may be due to crystal packing. In chains A and P, the first residues visible in the electron density were Val 57 and Lys 56 , respectively ( Fig. 5 A). In chain A, residues could be fit within the electron density to Ser 350 , but in chain P, the residues could be fit only to Gln 348 . In chain A, there is a disordered region from Ser 181 to Asp 183 , resulting in loss of 㬧 (residues 182�), part of a hairpin loop that binds ankyrin (57). One other difference is in a loop region (residues 202�) seen in the pH 4.8 structure that is more disordered in the pH 6.5 structure, extending further from residue Glu 202 to Asp 218 , resulting in loss of a short helix (㬖 residues 212�) visible at pH 4.8. The new crystal structure indicates that regions of cdAE1 involved in protein interactions are dynamic and can assume different conformational states at different pH values, perhaps folding up upon protein binding. Overall, the structure is very similar over residues 55� to the structure (Protein Data Bank code 1HYN ) first published by Low and co-workers (24) (root mean square deviation was 1.14 Å over 530 aligned residues using SSM in Coot), showing that there is good agreement between the core protein structures obtained at pH 4.8 and 6.5 under two different crystallization conditions, crystal forms, and space groups ( Fig. 5 B). The differences in the structure of the loop regions involved in protein interactions are of significance because some regions folded and buried at low pH become unfolded and accessible at physiological pH.

    Using the pH 6.5 crystal structure, the possible tunnel region around Arg 283 is illustrated in Fig. 5 , C and D. Arg 283 is located in the middle of 㬗 (residues 278�). As indicated by Chang et al. (23), Arg 283 is in an occluded, solvent-inaccessible region of the protein. There is a hydrogen bond between the side-chain nitrogen of Arg 283 to the side-chain oxygen of Glu 85 (2.74 Å), which is located near the beginning of 㬣 (residues 84�). In turn, the carbonyl side chain of Glu 85 makes a hydrogen bond to the NH2 of Arg 283 . In addition, Arg 283 also makes two hydrogen bonds to the main-chain carbonyl of His 101 . Arg 283 also makes a hydrogen bond with the hydroxyl group on Glu 280 located three residues proximal on the same side of helix 7. Glu 85 in turn makes hydrogen bonds to Asn 87 and Ser 100 . Glu 86 makes a hydrogen bond to Pro 213 near the beginning of helical segment 㬖 (residues 212�), which is destabilized at pH 6.5. A mutation of Arg 283 to Ser would result in disruption of this elaborate H-bonding network and could destabilize the protein. Indeed, all attempts to crystallize the R283S or R283A mutants under conditions similar to the wild-type protein failed, indicating a disturbed protein structure. Therefore, we carried out a series of biophysical studies to determine the effect of the mutations on the stability of the isolated cytosolic domain.

    Sensitivity of cd� Tunnel Mutants to pH and Urea Denaturation

    The cdAE1 undergoes dramatic changes with pH, transitioning from a compact structure under acidic conditions to a more extended and open structure at neutral and alkaline conditions (24, 26, 55, 58). Titration of cd� showed a typical increase in intrinsic fluorescence going from acidic to alkaline pH arising from dequenching of clustered tryptophan residues ( Fig. 6 A). The R283S mutant underwent a similar transition but had a higher intrinsic fluorescence at low pH than the wild-type protein. This feature is consistent with a more open structure at low pH as was also observed for kidney cdAE1 (35). A similar effect was seen for the other mutants with a higher intrinsic fluorescence at low pH than wild type and an increase in fluorescence at alkaline pH (supplemental Fig. 1). The wild-type cd� protein and the R283S mutant had identical CD spectra ( Fig. 6 B), indicating that this point mutation induced no major change in the secondary structure of the domain.

    Effect of R283S mutation on the biophysical properties of cd�. A, effect of pH on the intrinsic fluorescence of cd� and the R283S mutant. Both proteins showed an increase in fluorescence at alkaline pH with the mutant exhibiting a higher fluorescence at low pH values, consistent with a more open structure. B, circular dichroism (CD) spectra of cdD54AE1 and the R283S mutant in 100 m m NaCl, 20 m m Tris-HCl, pH 8.0. C, gel filtration profiles of cd� and the R283S mutant. Samples were applied to an S200 HiLoad 16/60 column equilibrated in 100 m m NaCl, 20 m m Tris-HCl, pH 8.0. The major peak corresponds to the dimeric form of the proteins. AU, absorbance units.

    The sensitivity of wild type and tunnel mutants of cd� to urea denaturation was examined at different pH values (supplemental Fig. 2). At pH 10.5 when cd� has an extended conformation, urea resulted in protein unfolding with a decrease in intrinsic fluorescence at urea concentrations above 3 m . The intrinsic fluorescence of the tunnel mutants had a similar pattern, although a decline in intrinsic fluorescence was observed for all the mutants by 3 m urea, indicating a slightly lower stability. At pH 8.5, cd� exhibited an initial increase in intrinsic fluorescence, peaking between 2 and 3 m urea and then declining at higher urea concentrations. The increase is due to dequenching of the tryptophan as the domain begins to unfold, whereas the decrease is due to exposure of the tryptophans to solvent as unfolding proceeds. The mutants showed a similar pattern with an increase in intrinsic fluorescence up to 2 m urea followed by a decrease. At pH 6.5, the increase in intrinsic fluorescence for wild type and the tunnel mutants occurred at higher urea concentrations (5 m ), consistent with a more stable structure at low pH. An intermediate effect was seen at pH 7.5. These denaturation studies support the view that the tunnel mutations affected the stability of the cytosolic domain.

    The cd� (monomer calculated molecular weight, 34,739) eluted as a major peak on an S200 16/600 gel filtration column with an apparent molecular mass of 122 kDa with a smaller amount of a higher molecular weight peak ( Fig. 6 C). The major peak corresponds to a dimer the larger apparent molecular weight is due to the asymmetric nature of the dimer (55). The R283S mutant (monomer calculated molecular weight, 34,669) eluted as a major peak with a slightly larger apparent molecular mass of 143 kDa, consistent with a more asymmetric structure as well as an earlier peak ascribed to a tetramer. Light scattering measurements (supplemental Fig. 3) using a Malvern Viscotec low angle light scattering instrument connected to an S200 10/300 column showed that the wild-type cd� dimer had a molecular mass of 73.5 kDa and a radius of hydration of 3.6 nm. The R283S dimer had a molecular mass of 71.4 kDa with a larger radius of hydration of 4.2 nm, indicating a more asymmetric structure. The mutant dimer tended to form tetramers upon rechromatography, forming a new peak with a molecular mass of 159 kDa and a radius of hydration of 6.7 nm with small amounts of higher oligomers eluting at the void volume, whereas the wild-type protein retained a stable dimer oligomeric structure. These results show that the R283S mutation had a destabilizing effect on cd�, resulting in a more asymmetric protein that is prone to aggregation, the likely cause of our inability to crystallize the mutants.


    Abstract

    OxlT, the oxalate/formate exchanger of Oxalobacter formigenes, is a member of the major facilitator superfamily of transporters. In the present work, substrate (oxalate) was found to enhance the reactivity of the cysteine mutant S336C on the cytoplasmic end of helix 11 to methanethiosulfonate ethyl carboxylate. In addition, S336C is found to spontaneously cross-link to S143C in TM5 in either native or reconstituted membranes under conditions that support transport. Continuous wave EPR measurements are consistent with this result and indicate that positions 143 and 336 are in close proximity in the presence of substrate. These two residues are localized within helix interacting GxxxG-like motifs (G140LASG144 and S336DIFG340) at the cytoplasmic poles of TM5 and TM11. Pulse EPR measurements were used to determine distances and distance distributions across the cytoplasmic or periplasmic ends of OxlT and were compared with the predictions of an inside-open homology model. The data indicate that a significant population of transporter is in an outside-open configuration in the presence of substrate however, each end of the transporter exhibits significant conformational heterogeneity, where both inside-open and outside-open configurations are present. These data indicate that TM5 and TM11, which form part of the transport pathway, transiently close during transport and that there is a conformational equilibrium between inside-open and outside-open states of OxlT in the presence of substrate.


    Conclusions and future directions

    The development of plant platforms dedicated to the production of glycosylated PMPs for parenteral application in humans requires the consideration of both N- and O-glycan-specific glycoepitopes. Ongoing efforts to optimize glycan composition for lower immunogenicity are currently exclusively focused on N-glycans. Indeed, very little attention has been paid until now to the presence of plant-specific O-glycans on PMPs, although many therapeutic proteins already produced in plant expression systems are very good candidates for Pro hydroxylation and Hyp O-glycosylation, as notably illustrated with human IgA produced in maize ( Karnoup et al., 2005 ).

    Engineering N-glycosylation in plants could improve the efficiency of PMPs, not only by reducing plant N-glycan immunogenicity in humans, but also by providing plant expression systems dedicated to the production of therapeutic protein glycovariants hardly produced at low cost in cultured mammalian cells. For instance, antibodies with high-Man-type N-glycans, which show promise for cancer therapy because of their rapid clearance in non-cancerous tissues in vivo, can be readily obtained in plant systems using protein retention in the ER or GNTI knockdown, thus providing a possible alternative to Lec 1 mutant CHO cells ( Wright and Morrison, 1998 ). Another illustration for the potential of plant cells in antibody production concerns the so-called antibody-dependent cellular cytotoxicity (ADCC) process, a lytic attack on antibody-targeted cells considered as a major function of “anti-tumor” therapeutic antibodies. ADCC activity depends on the presence and structure of the N-glycans at position Asn-297 on the heavy chains, as illustrated by the enhanced ADCC activity of antibody glycoforms devoid of α1,6 fucose in their N-glycan chains ( Shields et al., 2002 Shinkawa et al., 2003 Niwa et al., 2005 Ferrara et al., 2006 ) and the recent development of a stable high-producing CHO glycoengineered cell line for large-scale production of non-fucosylated therapeutic antibodies ( Kanda et al., 2006 ). Interestingly, the lack of α1,3 linked fucose on the N-glycans of an antibody produced in duckweeds or Arabidopsis after α1,3 FucT knockout has the same positive effect on ADCC activity as the removal of the α1,6 fucose on an antibody produced in the fucose deficient CHO cell line ( Cox et al., 2006 Schähs et al., 2007 ).

    It is also noteworthy that the availability of glycoengineered plants is not required for all PMPs. For instance, N-glycans on plant-made human glucocerebrosidase are suitable for enzyme replacement therapy of Gaucher disease, without the need for prior in vitro glycan processing as described for glucocerebrosidase produced in CHO cells ( Shaaltiel et al., 2007 ). Plant-specific N-glycosylation could also represent a significant advantage in some cases, notably for recombinant vaccine antigens. The promise of plant-made recombinant vaccines has been amply demonstrated in recent years, with more than 200 papers describing the production of vaccines and allergens in plants ( Faye and Gomord, 2010 ), and the successful development of a Newcastle disease virus vaccine for poultry produced in suspension-cultured tobacco cells, registered and approved by the US Department of Agriculture in January 2006 ( Vermij and Waltz, 2006 ). Besides their acknowledged advantages for fast and high-yield production of parenterally delivered vaccines (see McCormick et al., 2008 D’Aoust et al., 2009 D’Aoust et al., 2010 for recent illustrations), plant expression systems are likely to contribute to a broader use of inexpensive oral vaccines in the future (see Mestecky et al., 2008 and Rybicki, 2009 for recent reviews). To this end, plant-specific strategies have been identified to increase antigen heat stability and resistance to enzymatic digestion in the gastrointestinal tract, including recombinant protein incorporation into biodegradable particles such as lipid or natural or artificial protein bodies ( Nochi et al., 2007 http://www.sembiosys.com and http://www.erabiotech.com). Several mucosal adjuvants have also been investigated to enhance the immunogenicity and uptake of plant-made antigens by the intestine for oral vaccination, or alternative routes such as intranasal via mucosal surfaces. The use of plant N-glycans as glycoadjuvants and their capacity to bind Man receptors at the surface of antigen-presenting cells, however, has not yet been evaluated in vivo, although recent results obtained with a plant-made human glucocerebrosidase have illustrated the capacity of plant N-glycans to bind these receptors ( Shaaltiel et al., 2007 ). Recent attempts in our laboratory also proved promising towards the development of plant-specific glycoadjuvants for immunization with plant-made mucosal vaccines. We notably observed that the presence of plant N-glycans on a recombinant allergen could represent an advantage in sublingual-specific immunotherapy of allergic diseases (Gomord, V., unpub. data). Altogether, these results indicate that, in addition to their well-described advantages for fast, high yield, low cost and contamination free production of pharmaceutical proteins, plants are now emerging as a powerful expression system for the production of therapeutic protein glycovariants showing similar, or even higher, biological activity than protein homologs expressed in cultured mammalian cells.


    Watch the video: Wie hängen genetische Vielfalt und die Anpassung an wechselnde Umweltbedingungen zusammen? (November 2021).